Contrast the pre-union development of south africa’s constitutional law history with the post-apartheid period with reference to the application of the ‘rule of law’

Answers

Answer 1

South Africa's constitutional law history pre-union was characterized by the colonial powers' imposition of their legal systems on the indigenous people. The colonial powers treated African customary law as inferior and refused to recognize it.

The apartheid regime's constitutional law was designed to maintain white supremacy and exclude non-white South Africans from political and social participation. The post-apartheid period, on the other hand, is marked by the promotion of the rule of law, democracy, and constitutionalism.

The 1996 Constitution guarantees equal protection and benefit of the law to all South Africans and recognizes customary law as equal to common law. The judiciary is independent and has the power of judicial review. The rule of law has been used to ensure that government decisions are lawful, rational, and procedurally fair.

However, challenges remain, such as the slow pace of land reform and the widespread corruption in government. Nonetheless, South Africa's post-apartheid constitutional law history demonstrates a commitment to the rule of law and the principles of democracy and constitutionalism.

To know more about colonial powers visit:

https://brainly.com/question/14465232

#SPJ11


Related Questions



criminal justice is a system of procedures and processes to protect people, bulldings and property, and
information?

Answers

Yes, criminal justice is a system of procedures and processes that are designed to protect people, buildings, property, and information from criminal activity.

The criminal justice system includes law enforcement agencies, the courts, and correctional facilities. The primary goal of the criminal justice system is to prevent crime by deterring potential offenders and by punishing those who do commit crimes.

To achieve this goal, the criminal justice system relies on a range of tactics, including investigation and surveillance, prosecution and trial, sentencing, and incarceration. The system also aims to provide support and services to victims of crime and to promote rehabilitation and reintegration for offenders.

The criminal justice system is complex and constantly evolving, and it plays a critical role in maintaining the safety and security of communities.

To know more about criminal justice visit:

https://brainly.com/question/30629034

#SPJ11

Which of the following is NOT one of the types of sanctions traditionally (i.e. commonly, imposed at least a few times annually) imposed upon individuals convicted of a criminal offense in the U.S. criminal justice system.
Question 8 options:

Imprisonment

Capital Punishment

Monetary Fines

Corporal punishment

Answers

Capital punishment is no longer commonly imposed as a sanction in the United States in most jurisdictions, so it is not one of the types of sanctions traditionally imposed upon individuals convicted of a crime in the U.S. criminal justice system.

a mother executes a deed stating that upon her death the property will convey to her son, abraham lacey. the mother created which type of estate?

Answers

A mother signs a deed stating that her son, Abraham Lacey, will inherit the property upon her death. A specific kind of life estate was created by the mother. The correct answer is (D).

If a woman's mother acquires a property through her will, gift, inheritance, or self-acquired property, she becomes the sole owner. The Hindu Succession Act of 1956 (the Act) governs how a mother's property is divided according to Hindu law. Intestacy succession is covered by the Act.

The mother cannot dispose of the ancestral property she received in accordance with her will. Therefore, you may challenge and request a portion of that. If the gift deed was signed under questionable circumstances, you can challenge it. Otherwise, the mother can sign a registered gift deed to transfer her assets to anyone.

To learn more about life estate here

https://brainly.com/question/30761355

#SPJ4

Q- A mother executes a deed stating that upon her death the property conveys to her son, Abraham Lacey. The mother created which type of estate?

a) Estate in revision

b) Estate for years

c) Nonfreehold estate

d) a Life estate

Tricia found a body that is in rigor mortis. How was she MOST likely to determine that this was happening?

Answers

Answer:

Explanation:

Rigor mortis is the stiffening of the body's muscles that occurs after death, due to a chemical change in the muscle tissue. The onset and progression of rigour mortis can provide valuable information about the time of death and can be used to help determine the cause of death.

Tricia is most likely to determine that the body is in rigour mortis by observing the stiffness and rigidity of the body's muscles. During rigour mortis, the body becomes stiff and immobile, and the muscles are difficult to move or manipulate. This stiffness typically begins within a few hours after death and reaches its peak after approximately 12-24 hours, before gradually diminishing over the next 24-48 hours.

Tricia could also confirm rigour mortis by attempting to move the body's joints or limbs. During rigour mortis, the joints become fixed and difficult to move, and the limbs may be difficult to flex or extend. Additionally, Tricia may observe other signs of death, such as livor mortis (a purplish-red discolouration of the skin due to blood settling) and algor mortis (the cooling of the body temperature after death).

PLS MARK ME BRAINLIEST

Tricia most likely determined that the body was in rigor mortis by observing the stiffening of the muscles and joints. Rigor mortis is a postmortem process where the body becomes stiff due to the depletion of ATP, which is necessary for muscle relaxation. This stiffness usually starts within 2-4 hours after death and reaches maximum stiffness in about 12 hours. Therefore, if Tricia observed a stiff and immobile body, it would be a strong indication that the body was in rigor mortis.


To determine rigor mortis, Tricia would have:

1. Checked for stiffness: She would have noticed that the body's muscles were stiff and difficult to move, indicating that rigor mortis had set in.
2. Assessed the body's temperature: Rigor mortis typically starts a few hours after death, and the body would be cold to touch at this stage.
3. Looked for other post-mortem signs: To be certain of rigor mortis, Tricia might also have checked for other post-mortem changes such as livor mortis (discolouration of the skin) or algor mortis (body temperature decrease).

By observing these signs, Tricia was most likely able to determine that the body was in rigor mortis.

Learn more about rigor mortis: https://brainly.com/question/13554527.

#SPJ11

Identify the functions of court systems related to sancturary cities in the resources provided?
senate bill 4 was all that was provided.

Answers

Senate Bill 4 (SB4) is a state-wide law in Texas that is designed to bar sanctuary cities from existing.

This law seeks to do this by requiring local law enforcement officials to cooperate with federal immigration enforcement efforts and to allow the federal government to enforce immigration laws in local jurisdictions. It also requires local officials to act on behalf of federal immigration agents when asked.

This law is intended to deter illegal immigration and punish local governments that choose to ignore federal immigration laws. By including stiff penalties for noncompliance and by allowing the state to pursue legal action against local officials who fail to comply, SB4 is intended to serve as a deterrent to sanctuary city policies. In addition, SB4 also provides a mechanism for the state to monitor and enforce compliance with the law. This includes the ability to take legal action against sanctuary cities if they fail to comply.

To know more about Senate Bill , click here:

https://brainly.com/question/11494587

#SPJ4

What branch of government do regulatory agencies fall under?.

Answers

Regulatory agencies are part of the executive branch of government. These agencies are responsible for enforcing laws and regulations related to specific industries or areas of governance, such as the environment, public health, and workplace safety. Regulatory agencies are often created by Congress to address specific issues or concerns, and are given a degree of autonomy to carry out their duties. While regulatory agencies are part of the executive branch, they are typically independent of direct control by the President or other executive officials, and are instead overseen by a board or commission. Some examples of regulatory agencies include the Environmental Protection Agency (EPA), the Food and Drug Administration (FDA), and the Occupational Safety and Health Administration (OSHA).

One major role of independent regulatory commissions is to:
a. advise the president on national security issues.
b. make sure businesses are following the law.
c. offer goods and services to the public.
0 0
d. run the day-to-day operations of the white house.

Answers

One major role of independent regulatory commissions is to make sure businesses are following the law. Hence option B) is the correct answer.

Independent regulatory commissions are agencies created by the government to oversee and regulate specific industries or sectors. Their primary function is to establish and enforce rules that businesses must adhere to in order to ensure fair competition, protect consumer interests, and maintain the stability of the market.

These commissions operate independently from the executive, legislative, and judicial branches of the government to ensure impartiality and prevent undue influence. They create regulations, monitor compliance, and take enforcement actions when necessary, such as issuing fines or revoking licenses.

Examples of independent regulatory commissions include the Federal Trade Commission (FTC), which focuses on consumer protection and anti-competitive practices, and the Federal Communications Commission (FCC), which regulates interstate communications by radio, television, wire, satellite, and cable.

In summary, the major role of independent regulatory commissions is to make sure businesses are following the law by creating and enforcing regulations that protect consumers, promote fair competition, and maintain market stability.

To learn more about independent regulatory commissions, visit: https://brainly.com/question/30749545

#SPJ11

Online contracts: carlos sees offer for 2 free tickets to basketball game online. he quickly hits the 'i accept' button. after reading the fine print, he realizes that by accepting the offer, he signed up for a 1 year subscription, which he must pay for upon receipt. is carlos bound by the agreement?

(yes) or (no)

Answers

Yes, Carlos is bound by the agreement by hitting the 'I accept' button he entered in a legally binding contract.

A legally binding agreement is a pact between two or more parties in which they make a commitment to do or refrain from doing something. It may be expressed verbally, in writing or inferred from the actions of the parties. A valid agreement must contain a number of essential components, including an offer, acceptance, consideration, the parties legal capacity, and a legitimate purpose.

Even if he did not read the fine print by clicking the "I accept" button he entered into a legally binding contract with the company selling the tickets. Before accepting an online offer, it is typically taken for granted that the person has read and comprehended the terms and conditions.

It is crucial to thoroughly read and comprehend any agreement before agreeing to its terms whether online or in person.

Learn more about binding contract at:

brainly.com/question/30750666

#SPJ4

What was the supreme court’s ruling in new york times co. V. Sullivan?.

Answers

The Supreme Court's ruling in New York Times Co. v. Sullivan was that public figures must prove actual malice in order to establish a claim for defamation.

In other words, the Supreme Court decided that for a public figure to win a defamation case against a news organization, they must demonstrate that the news organization acted with actual malice, meaning they knew the information was false or acted with reckless disregard for the truth.

This decision established a higher standard of proof for public figures in defamation cases, in order to protect the First Amendment rights of the press. New York Times Co. v. Sullivan was a landmark case in the field of American defamation law. It arose out of an advertisement that the New York Times published in 1960, which solicited funds for the civil rights movement in the southern United States.

To know more about Supreme Court, click here.

https://brainly.com/question/12848156

#SPJ4

please answer
Which of the following psychological factors impact the reliability of eyewitness testimony?

Anxiety
Eyesight
Perception
Sensory overload

Answers

To answer your question of which of the following of the physiological factors impact the reliability of eyewitness testimony, the answer should be Sensory overload.

What can be derived from a firearm and its projectiles?

Answers

Firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.

What informs firearms and their projectiles?

Firearms and their projectiles can provide a wealth of information to investigators and forensic experts in criminal investigations, as well as to engineers and researchers studying the performance and characteristics of firearms.

From a firearm, one can determine its make, model, and caliber. The firearm's serial number can also be used to trace its ownership and history. The condition of the firearm can provide information about its maintenance and use.

From the projectile, one can determine the caliber, type of bullet, and the angle of impact. The projectile's trajectory can be used to determine the location of the shooter and the direction of the shot.

Forensic experts can also analyze the gunshot residue left on the firearm and the shooter's hands to determine if the person fired the weapon. The presence of fingerprints or DNA on the firearm can also be used to identify the shooter.

Overall, firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.

learn more about Firearms and their projectiles: https://brainly.com/question/30244650

#SPJ1

On Halloween night, John and several of his friends decided to pull some pranks at their high school and damaged some of the classrooms. The next morning, school security officers reviewed the security videotapes to see who had done the damage. What will the students be charged with?

Answers

Answer:

The students may be charged with vandalism or malicious mischief, which involves damaging or defacing property without the owner's consent. Depending on the severity of the damage, the charges could be a misdemeanor or a felony. In addition to criminal charges, the students could also face disciplinary action from their school, including suspension or expulsion. It is important to note that vandalism is a serious crime and can have long-lasting consequences for the individuals involved.

Explanation:

Should a Loss Prevention Officer be able to put his hands on and hand-cuff a child (5-13) to protect store property?

Answers

It is not appropriate for a Loss Prevention Officer to physically restrain or handcuff a child (5-13) to protect store property, as it should only be used in situations where there is an imminent threat to safety.

Who is a Loss Prevention Officer?

A Loss Prevention Officer is an employee of a business who is responsible for preventing theft and other losses within the store.

A Loss Prevention Officer should not physically restrain or handcuff a child (aged 5-13) to protect store property. The use of physical force or restraints should only be used in situations where there is a clear and imminent threat to the safety of the public or the officer, and where it is necessary to prevent harm.

The use of force on a child should be a last resort and must be proportionate to the situation. Additionally, many jurisdictions have laws and regulations in place that prohibit the use of physical force or restraints on minors, except in extreme cases of danger.

Learn more about Loss Prevention Officer on:

https://brainly.com/question/30214543

#SPJ1

Which of these is considered the heart of the complaint ? a. the request for relief b. the statement of claim c. the court jurisdiction and the name of parties involved d. detailed information on the plaintiff and the defendant

Answers

The heart of the complaint is generally considered to be the request for relief, which outlines what the plaintiff is seeking from the court. Therefore, Option A) is correct.

The request for relief is typically the most important part of the complaint because it sets out the specific remedy or remedies that the plaintiff is seeking.

The statement of claim provides the background information and details of the dispute, while the court jurisdiction and the name of the parties involved simply identify the court and the parties to the action.

Detailed information on the plaintiff and defendant may be important for establishing jurisdiction or for other procedural matters, but it is not typically the most significant aspect of the complaint.

In summary, the request for relief is the key element of the complaint as it identifies what the plaintiff hopes to achieve through the legal process.

To learn more about the plaintiff, visit: https://brainly.com/question/28425238

#SPJ11

What is methodology in research paper

Answers

Introduction:

Methodology is a crucial aspect of any research paper. It involves the systematic and logical approach taken by a researcher in the collection, analysis, and interpretation of data to address the research question or objective. The methodology section of a research paper is a critical part that outlines the methods, techniques, and procedures used to gather and analyze data and how the findings were interpreted to answer the research question. The purpose of this paper is to discuss the importance of methodology in research and how to develop a strong methodology section in a research paper.

Importance of Methodology in Research:

Methodology is essential in research as it helps to establish the credibility and reliability of the research findings. It ensures that the research is conducted in a systematic and logical way, which minimizes bias and errors in the results. Additionally, a strong methodology section enables other researchers to replicate the study and verify the findings, contributing to the advancement of knowledge in the field.

Developing a Strong Methodology Section:

A strong methodology section should provide a detailed description of the methods, techniques, and procedures used to collect and analyze data. It should begin by explaining the research design, which outlines the overall strategy that the researcher used to answer the research question. The research design can be qualitative, quantitative, or mixed methods, and it should be chosen based on the research question, data collection methods, and data analysis procedures.

The next part of the methodology section should describe the population and sampling methods used in the study. The population is the entire group of individuals that the researcher is interested in studying, while the sample is a smaller subset of the population that is used to represent the entire population. The sampling method used should be appropriate for the research design and research question, and it should ensure that the sample is representative of the population.

The data collection methods used in the study should also be described in detail. The data collection methods can be primary or secondary, and they can involve qualitative or quantitative techniques. The researcher should explain how the data was collected, the tools used to collect the data, and any ethical considerations that were taken into account.

The data analysis procedures used to analyze the data should also be described in detail. The analysis procedures can be descriptive or inferential, and they should be appropriate for the research question and data collection methods. The researcher should explain how the data was analyzed, the statistical tests used, and how the findings were interpreted to answer the research question.

Conclusion:

In conclusion, methodology is a crucial aspect of any research paper. It involves the systematic and logical approach taken by a researcher in the collection, analysis, and interpretation of data to address the research question or objective. A strong methodology section is essential in establishing the credibility and reliability of the research findings, enabling other researchers to replicate the study and verify the findings, contributing to the advancement of knowledge in the field. Developing a strong methodology section involves providing a detailed description of the research design, population and sampling, data collection methods, data analysis procedures, and ethical considerations.

How do the characteristics listed those on parole play into our own cultural and racial biases ? What can be done to help counteract such a stereotype? I need help with this question

Answers

The characteristics that are typically associated with individuals on parole, such as a criminal history, low socioeconomic status, and minority status, can often lead to cultural and racial biases that unfairly impact these individuals.

These biases can lead to discrimination and prejudice, which can negatively affect the ability of individuals on parole to reintegrate into society and obtain employment, housing, and other essential resources.

To counteract these stereotypes, it is important to raise awareness about the negative effects of cultural and racial biases and to promote education and training that emphasizes the importance of treating all individuals with respect and dignity. This can be achieved through various means, including:

Education and awareness campaigns - these can be designed to raise awareness about the negative effects of cultural and racial biases and to promote understanding and acceptance of diversity.

To learn more about  stereotype  here

https://brainly.com/question/361502

#SPJ4

What is the STR found within the DNA sequence? TCATGCGATGATGATGATGATCGCT


A. CAT


B. GCG


C. ACG


D. GAT

Answers

The STR (short tandem repeat) found within the DNA sequence is "GAT", which is repeated five times in a row. The correct option is D.

In the given DNA sequence "TCATGCGATGATGATGATGATCGCT" The term "STR" stands for "Short Tandem Repeat" which is a nucleotide sequence that repeats. A section of DNA known as an STR is made up of a few nucleotides that are repeated in tandem. The repeated sequence in the given sequence "GAT" appears five times in a row. In forensic science repeating sequences are frequently used to identify people.

It is a particular area of DNA where a short nucleotide sequence repeats several times in a row. Individuals can differ in the number of repeats, which is used as a distinctive genetic marker for identification. The analysis of STRs is used in DNA profiling and genetic fingerprinting to ascertain an individual's genetic make up. The correct option is D.

Learn more about Short Tandem Repeat at:

brainly.com/question/29661522

#SPJ4

Susan works at the local grocery store stocking shelves. She wants to learn how to operate the cash register and work as a cashier, but she does not know how to talk to her boss about it. You are not sure if this is a good idea because you know that the cashier shifts are longer and less flexible. You do not think the schedule change would work well for Susan. Which of the following actions would MOST support self-advocacy?

Answers

The actions would MOST support self-advocacy is You explain to Susan that the cashier schedule would be too hard for her. You ask her not to talk to her boss about a change.

What is self advocacy

Self-advocacy stands for the act of supporting oneself and defending one's own interests, necessities, and entitlements. To this end, individuals proactively express themselves verbally, make determinations and take actions solely on their behalf so as to enhance the quality of their existence and accomplish objectives they have set out to achieve.

For those persons confronted with disabilities, such personal representation acquires even more significance, because they run up against considerable challenges in securing services, support networks or exercising their individual rights when compared to other members within a community.

Read more on self advocacy  here:https://brainly.com/question/10346595

#SPJ1

complete question
Susan works at the local grocery store stocking shelves. She wants to learn how to operate the cash register and work as a cashier, but she does not know how to talk to her boss about it. You are not sure if this is a good idea because you know that the cashier shifts are longer and less flexible. You do not think the schedule change would work well for Susan. Which of the following actions would MOST support self-advocacy?

a) You arrange a meeting with Susan and her employer so you can talk about the accommodations Susan would need to fill the cashier role.

b) You help Susan plan out the steps of asking her boss for a meeting. You also help her type notes about what she wants to say in the meeting.

c) You tell Susan you are excited to hear that she is pursuing her goals, and ask her to let you know the outcome of her discussion with her boss.

d) You explain to Susan that the cashier schedule would be too hard for her. You ask her not to talk to her boss about a change.

Suppose that, under a new city ordinance, police officers would have a choice when it comes to dealing with persons possessing less than four ounces of marijuana. relying on their discretion, officers could (a) arrest the offender, leading to possible jail time; or (b) write the offender a ticket, treating the infraction like a traffic violation. would this be a just and fair policy? would it make it easier or more difficult for police officers to protect the community? why or why not?

Answers

Under the proposed city ordinance, police officers would have discretion when dealing with individuals possessing less than four ounces of marijuana. They could either (a) arrest the offender, leading to possible jail time or (b) write the offender a ticket, treating the infraction like a traffic violation.

Whether this policy is just and fair depends on various factors, such as the potential for unequal treatment, the prioritization of law enforcement resources, and the impacts on the community. On one hand, allowing officer discretion could lead to inconsistencies and potential biases in how offenders are treated. On the other hand, treating minor marijuana possession as a traffic violation could reduce the burden on the criminal justice system and allow officers to focus on more serious crimes.

As for the impact on police officers protecting the community, this policy could make it easier for them to allocate resources more effectively and concentrate on higher-priority issues. However, if discretion is not applied consistently and fairly, it could create mistrust and tensions within the community. Ultimately, the success of this policy would depend on how effectively it is implemented and monitored.

To know more about the Illegality of Marijuana Possession- https://brainly.com/question/29800924

#SPJ11

Which two of these founding documents were inspired by Enlightenment philosopher John Locke's ideas of "life, liberty, and property?



Α. The Declaration of Independence


B. The Articles of Confederation


C. The Virginia Statute of Religious Freedom


D. The U. S. Constitution

Answers

a) is the right answer

1. civil law may handle a court case involving ( point ) obattery. oassault . first - degree murder . onegligence . 2 . a defendant may be on trial in a criminal law court room if he or she is accused of ( 1 point ) onegligence . odrafting a faulty contract . orape . oneglecting alimony payments .

Answers

Civil law may handle a court case involving negligence, battery, assault, and first-degree murder.

These are a few illustrations of civil wrongs, also known as torts, which cause harm or injury to another person or their property. If a defendant is charged with assault, the case may be heard in a criminal law court. Non-consensual contact is a serious criminal offense  that is typically prosecuted in criminal court.

Falsely drafting a contract or failing to make alimony payments are not crimes and are typically dealt with in civil court or through an alternative dispute resolution process like mediation or arbitration.

Learn more about Civil law at:

brainly.com/question/14788507

#SPJ4

Discuss the notion of Ubuntu with reference to transformative constitutionalism,case law,and jurisprudence in your answer. ​

Answers

Ubuntu is a phrase that comes from the Bantu languages of southern Africa and is frequently translated as "humanity towards others." It is a philosophical idea that places a strong emphasis on the connectivity of all people as well as the value of kindness, empathy, and community.

Ubuntu has become a key value and principle in the creation of a new constitutional order that is based on social justice, human dignity, and the advancement of the common good in the context of transformative constitutionalism.

Ubuntu has been acknowledged as a fundamental value in South African legal doctrine for interpreting and applying the Constitution. The Constitutional Court ruled in the historic case of S v. Makwanyane that the death penalty was unconstitutional since it contravened the ideal of Ubuntu,

To know more about constitutionalism visit :

https://brainly.com/question/4278982

#SPJ4

What are some financial stressors in your life?

Answers

I think this is a personal question?
Give it some thought

The evidence in this chapter has strongly suggested that America is putting too many individuals in prison and that the costs of "mass incarceration " are very high If the United States was to reduce its prison population , however , alternative approaches to punishment will need to be expanded. What kinds of alternatives to prison do you think would be most effective , and why ? (A quick Internet search can suggest some possibilities for you to consider )

Answers

There are several alternatives to prison that can be used to reduce the prison population. Some of these alternatives include community service, probation, electronic monitoring, house arrest, drug treatment programs, mental health treatment programs and restorative justice programs.

Community service involves performing unpaid work for the community. Probation is a court-ordered period of supervision in the community. Electronic monitoring involves wearing an electronic device that tracks the offender’s movements. House arrest involves being confined to one’s home except for certain approved activities.

Drug treatment programs and mental health treatment programs are designed to help offenders overcome addiction or mental health issues that may have contributed to their criminal behavior. Restorative justice programs involve bringing together the offender and the victim to repair the harm caused by the crime.

The most effective alternative to prison depends on the individual offender and their circumstances. For example, drug treatment programs may be more effective for offenders with drug addiction problems while restorative justice programs may be more effective for offenders who committed crimes against individuals.

Learn more about Restorative justice: https://brainly.com/question/28913925.

#SPJ11

Who does Chief Justice Rehnquist say should be responsible for addressing the social problems of our
country?

Answers

Answer:

Through the popularly elected branches (not the unelected judiciary).

Explain with example that no job is inferior to any other​

Answers

To demonstrate that no job is inferior to any other, let's consider two different jobs: a doctor and a janitor. Each job contributes to society in its own unique way, and all are essential for maintaining the well-being of our communities.

A doctor is responsible for diagnosing illnesses, prescribing medications, and providing medical care to patients. Their job is crucial to maintaining the health and well-being of society. On the other hand, a janitor is responsible for maintaining cleanliness, sanitation, and safety in public places like hospitals, schools, and offices.

While some may argue that a doctor's job is superior due to their extensive education and the critical nature of their role, it's essential to recognize the importance of a janitor's work as well. Without janitors, public places would become unsanitary, leading to the spread of diseases and a decline in overall public health. In this sense, the janitor's role is just as vital to maintaining a healthy society as the doctor's role.

Learn more about no job is inferior to any other: https://brainly.com/question/18831347.

#SPJ11

does chase freedom unlimited have foreign transaction fees?

Answers

Answer:

Explanation:

No, Chase Freedom Unlimited does not have foreign transaction fees. This means that you can use your card for purchases outside the United States without incurring any additional fees. However, keep in mind that foreign merchants may charge a fee for using a credit card, which is separate from any fees charged by the card issuer. It is always a good idea to check with the merchant and your credit card issuer about any fees before making a purchase.

PLS MARK ME BRAINLIEST

4. using some of the insights from environmental criminology, do you think your neighborhood is likely to have high or low rates of crime? why? give specific examples in your answer.

Answers

Environmental criminology suggests that crime is not solely the result of individual characteristics, but is also influenced by environmental factors. These factors can include physical features of the environment, such as the layout of streets and buildings, as well as social and economic conditions, such as poverty and inequality.

Based on these factors, a neighborhood with high levels of crime might have characteristics such as:

Poorly maintained or abandoned buildings and public spaces, which may attract criminal activity.

High levels of poverty and unemployment, which can lead to desperation and criminal behavior.

A lack of social cohesion or community involvement, which can make it easier for criminals to operate without fear of detection.

A history of crime and violence, which can lead to a "culture of crime" in the area.

On the other hand, a neighborhood with low levels of crime might have characteristics such as:

Well-maintained public spaces and buildings, which can discourage criminal activity.

A strong sense of community and social cohesion, which can make it more difficult for criminals to operate unnoticed.

Good social and economic conditions, such as low levels of poverty and unemployment, which can reduce the likelihood of criminal behavior.

Good infrastructure and access to services, such as education and healthcare, which can improve overall quality of life and reduce desperation that can lead to crime

To learn more about criminology here

https://brainly.com/question/28996894

#SPJ4

how to get guardianship of a child without going to court

Answers

By signing some paperwork saying that you agree to have someone else as the guardian of the child.

Explain how the New York State Pension System Work

Answers

Your pension is determined by your years of credited service, retirement age, and final average salary (FAS).

FAS is the average of your earnings throughout the last 36 months of service when you earned the most. Typically, this is the last three years of employment.

The New York State Common Retirement Fund is a public pension plan for New York State government employees. It is the third largest public pension plan in the country, with $207.4 billion in assets as of 2018.

The New York State Comptroller's office oversees these assets, which are held on behalf of nearly one million members of the New York State and Local Retirement Systems (NYSLRS). Its one-year return was 11.35% as of March 31, 2018, however its 10-year return was 6.4%.

To know more about pension:

https://brainly.com/question/31215595

#SPJ1

Other Questions
When olivia read the passage she though fidgeting meant moving around What does Hilton caution the readers about the Exclusion zone and the animals that live there? Hooke's Law says that the force exerted by the spring in a spring scale varies directly with the distance that the spring is stretched. If a 39 pound mass suspended on a spring scale stretches the spring 10 inches, how far will a 48 pound mass stretch the spring? Round your answer to one decimal place if necessary What does the scholarly research tell us about the role of spirituality in treating addictions, particularly co-occurring disorders? Determine the mass of ammonium chloride, NH4Cl, required to prepare 0. 250 L of a 0. 35 M solution of ammonium chloride what is the sampling distribution of the sample mean? group of answer choices in practice, to estimate the mean values of a varibale in a large population, we only get to observe a sample, and we can only plot the distribution of this sample, not the distribution of the whole population. the distribution of the sample we have have observed is called the sampling distribution of the sample mean. if we hypothetically had a large number of samples taken from the same population, the distribution of the means of those individual samples is called the sampling distribution of the sample mean The number of males of a species of whale in Antarctic feeding grounds is w(x) when x million squid are present. Squid availability in the feeding grounds changes according to the surface temperature of the water so that the number of available squid is x(t) when the water is tF. In December, when water temperature is near 32F, there are an estimated 710 million deep-water squid in the feeding grounds, with the number of squid increasing by approximately 3 million squid per degree. At the same time, there are 6,000 adult male whales in the Antarctic feeding grounds, with the number of male whales increasing by 4 whales per million squid. Evaluate each of the following expressions when the surface temperature of the ocean is 32F, and write a sentence interpreting each value. (a) Evaluate x(t). x(32) = million squid Write a sentence interpreting the value. When water temperature is near 32F, the squid population is million squid. (b) Evaluate w(x). w(710) = whales Write a sentence interpreting the value. When there are 710 million squid there are adult male whales in the Antarctic feeding grounds. (C) Evaluate x million squid per degree Write a sentence interpreting the value. When water temperature is near 32F, the squid population is increasing by million squid per degree. (d) Evaluate dw dw whales per million squid dx x = 710 Write a sentence interpreting the value. What is the percentage composition of each element in dinitrogen monoxide, n2o? (5 points) a 58.32% n; 41.68% o b 60.55% n; 39.45% o c 63.64% n; 36.36% o d 62.66% n; 37.34% o Water flows from the bottom of a storage tank. After t minutes, the water is flowing at a rate of r(t)=200-4t liters perminute, where 0t Thomas Jeffersons political party was the party. A triangle has side lengths of (7a + 2b) centimeters, (6a + 3c) centimeters, and(3c +46) centimeters. Which expression represents the perimeter, in centimeters,of the triangle? Prepare journal entries for the following credit card sales transactions (the company uses the perpetual inventory system). 1. sold $23,000 of merchandise, which cost $17,400, on mastercard credit cards. mastercard charges a 5% fee.2. sold $5,300 of merchandise, which cost $3,150, on an assortment of bank credit cards. these cards charge a 4% fee. What is the temperature of 5. 16g of helium gas at a pressure of 785 mmHg that occupies a 1. 00 L container? Consultant Air focuses business on high paying McKinseyConsultants, but to fill the plane, it also carries the generalpublic. It is flying a 100-seater jet from Atlanta to San Franciscoand the cons Mis amigos y yo estamos my ocupados. Elena ____ salsa los jueves en un club que en el centro. Which characteristic of the moon made it the best choice for the first manned space missions instead another celestial body like mars?. Find the error. A class must find the area of a sector of a circle determined by a arc. The radius of the circle is cm. What is the student's error? Graph the linear equation y=-3x-1 the type of interest rate derivative that offers payments in periods when the specific interest rate index falls below a specific interest rate is called a(n): interest rate floor plain vanilla swap interest rate collar interest rate cap meaning of m e a d meaning of m e a d