PLEASE HELP
Can someone please help, my teacher wants this done a certain way and I don't know how to do it.

PLEASE HELPCan Someone Please Help, My Teacher Wants This Done A Certain Way And I Don't Know How To

Answers

Answer 1
This is how I did it.
PLEASE HELPCan Someone Please Help, My Teacher Wants This Done A Certain Way And I Don't Know How To
Answer 2
Hey I hope this helps :)
PLEASE HELPCan Someone Please Help, My Teacher Wants This Done A Certain Way And I Don't Know How To

Related Questions

Describe a rule for determining how much the store charges based on the number of turkey subs delivered.

Answers

The rule for determining how much the store charges based on the number of turkey subs delivered will depend on the pricing structure that the store uses. One possible rule is a linear function, where the cost of each turkey sub is a fixed amount and the total cost is proportional to the number of subs delivered.

For example, if the store charges $5 for each turkey sub, the rule could be:

Total cost = $5 per sub * Number of subs delivered

So if the store delivers 10 turkey subs, the total cost would be:

Total cost = $5 per sub * 10 subs = $50

If the store delivers 20 turkey subs, the total cost would be:

Total cost = $5 per sub * 20 subs = $100

This rule assumes that the cost per sub remains constant regardless of the number of subs delivered. However, in reality, the cost per sub may vary depending on factors such as the cost of ingredients and labor, and the store's desired profit margin.

Which number sentence is true?

Answers

Answer:

1. B     2. D      3. C

Step-by-step explanation:

1.B 2.D 3.C
I’m sorry if I’m wrong

.....................................

Answers

Answer:

282 cubic inches

Step-by-step explanation:

Let's have A be the top figure, B the middle, and C the bottom.

First, we need the volume for A, B, and C. And after, add them up.

Figure A : 1 · 5 · 2 = 10 cubic inches

Figure B : 3 · 3 · 8 = 72 cubic inches

Figure C : 10 · 4 · 5 = 200 cubic inches

Now we add A+B+C, so the equation is:

                10+72+200=282 cubic inches

Hence, the volume of the this figure is 282 cubic inches.

the volume of the figure is 282 cubic inches

I NEED HELP ASAP with a science experiment give me ideas what experiments (mini-labs) I could do based on the task! READ THE SCREENSHOT

Answers

Answer:  You should do a representation of how the heat and light waves reach humans on earth and keep us warm.

Step-by-step explanation:

all your answers are already in the task introduction.

1. Make earth out of styrofoam ball (buy at a dollar store) and paint. (blue and green). (If you want to make humans out of popsicle sticks)

2. Use velvet pipe cleaners (blue for cold air and red for hot air) to represent convection and conduction.

3. Use yellow pipe cleaners for solar energy to represent radiation.

4. Rest is up to you for how you want it to look.

I don’t know none of this type of work

100 POINTS PART B ANSWER ASAP MATHAMATIICS

Answers

Answer:need more info

Step-by-step explanation:

f: 14.75
g: 3
h: 29.83

Use figure 7.3.1 to answer the following questions.​

Answers

1) the above shape or polygon is called a Heptagon.

2) The vertices are:
V
I
O
L
E
N
T

3) the Angles are: ∠VIO, ∠IOL, ∠OLE, ∠LEN, ∠ENT, ∠NTV, and ∠TVI.
4) the sides are: VI, IO, OL, LE, EN, NT, NV

5) It has seven sides.

6) TV and VI are called adjacent sides or adjacent edges because they are two sides that meet at the same vertex.

7) ∠E and ∠N are called adjacent angles.

8) ∠O and ∠L would also be adjacent angles. This is because, they share the same side.
9) the angles adjacent to ∠I are: ∠O and ∠V.
10) the line that goes from vertex V to vertex L (VL) can be called a diagonal.

What is a heptagon?


A heptagon is a polygon with seven sides and seven angles.


It is a two-dimensional geometric shape with seven vertices and seven interior angles, each of which measures 128.57 degrees. The sum of the interior angles of a heptagon is 900 degrees.

Learn more about heptagon at:

https://brainly.com/question/12630702

#SPJ1

Please help with this one too! Thanks a bunch!♡

Answers

I think the answer would be 16,

7x-2+4x+6=180
11x+4=180
11x=176
176/11
x=16
the answer is x = 16

help me thank you so much

Answers

Answer:

the answer is shown in the image below

Step-by-step explanation:

Answer:

4 1/5 or 21/5 (improper fraction)

Step-by-step explanation:

To find the area of a rectangle, there is a formula:
[tex]A=lw[/tex]

So, we know the length is 7ft, and the width is 6/10.

Substitute in the 2 values:

[tex]A=7(6/10)[/tex]

From here, you can go 2 ways:

1) Change 6/10 to a decimal, 0.6

   -Then, multiply 7 x 0.6

   - This equals 4.2, which as a fraction is 4 1/5 or 21/5

2) Turn 7 into a fraction, 7/1 and multiply the numerators and denominators:

  - 7/1 x 6/10 = 42/10 = 21/5

Hope this helps! :)

At a recent baseball game of 5,000 in attendance, 150 people were asked what they prefer on a hot dog. The results are shown.


Ketchup Mustard Chili
63 27 60


Based on the data in this sample, how many of the people in attendance would prefer mustard on a hot dog?

Group of answer choices

900

2,000

2,100

4,000

Answers

Answer:

I haven't done anything like this for many years, but i think the answer is 900

Step-by-step explanation:

5000/ 150 = 33.33333333

33.3333333 X 27 = 900

Again, I haven't done this in forever, but I'm 99% sure it is 900. :)

900 would be the answer because;

27/150= 0.18
so 18% of the 150 people like mustard
then 0.18 x 5000= 900
meaning it’d be estimated around 900

Solve for x and y

NEED FOR TEST

Answers

Answer:

x = 4 and y = 6

Step-by-step explanation:

With the way the equations are set up, substation is faster.

Just substitute -1/2x + 8 for the y in the first equation.

3x + 4(-1/2x + 8) = 36


And then you can just solve the equation. You would get x = 4.

Substitute 4 for x.

y = -1/2(4) + 8

y = 6

X=4 Y=6 have a great day or night where ever you are and goodluck on your assignment :)

The formula for perimeter of a rectangle is 2(L+W). The length, L, is
and the width, W, is
. Write an expression for the perimeter of the rectangle. Make sure to simplify and write your answer in the form of ax+b.

Answers

1. 2(8x-1) + 2(2x+4)

2. 16x2 + 4x + 8

3. (20x+6)

PLEASE HELP IVE BEEN TAKING THIS MATH TEST FOR 5 HOURS
A 154-lb person burns 420 calories per hour riding an exercise bicycle at a rate of 15 mi/hr. Write a function rule to represent the total calories burned over time by that person. Explain how the information in the problem relates to the function.

Answers

Its ok to get one question wrong ‍♀️
let x=the time in hours


y = 420x is the function rule to represent the total calories burned over time.

PLS QUICK

Keith rolled a six-sided number cube with the numbers 1 through 6 and spun a spinner with 3 equal sections of yellow, blue, and red. Which table represents all of the possible outcomes of rolling the number cube once and spinning the spinner once?

Answers

Answer:

Here is the table that represents all of the possible outcomes of rolling the number cube once and spinning the spinner once:

Yellow Blue Red

1 Y1 B1 R1

2 Y2 B2 R2

3 Y3 B3 R3

4 Y4 B4 R4

5 Y5 B5 R5

6 Y6 B6 R6

Step-by-step explanation:

Hope that helps

Answer:

Step-by-step explanation:

Yellow Blue Red

1 Y1 B1 R1

2 Y2 B2 R2

3 Y3 B3 R3

4 Y4 B4 R4

5 Y5 B5 R5

6 Y6 B6 R6

The table shows the results of 500 experiments. Each experiment involved one person choosing one card from each of two identic decks of cards, labeled 1 through 5. What is the experimental probability of a person choosing a 2, then a 3? Express the answer as percent. ( I really need help with this, I tried looking at my notes and my brain literally can’t function )

Answers



Unfortunately, I cannot see the table you mentioned. However, I can explain how to calculate experimental probability and apply it to the given situation.

Experimental probability is the ratio of the number of times an event occurs to the total number of trials or experiments conducted. In this case, the event is a person choosing a 2, then a 3 from two identical decks of cards labeled 1 through 5.

Let's say we conducted 500 experiments, and in 50 of those experiments, a person chose a 2, then a 3. Then the experimental probability of choosing a 2, then a 3 is:

Experimental probability = (Number of times the event occurred) / (Total number of experiments) = 50 / 500 = 0.1

To express this as a percent, we simply multiply by 100:

Experimental probability as percent = 0.1 x 100% = 10%

Therefore, the experimental probability of a person choosing a 2, then a 3 from two identical decks of cards labeled 1 through 5, based on 500 experiments, is 10%.
It would be 10% hope that helps

A circular pool has a radius of 6 ft. What is the approximate circumference of the pool?

A. 19 ft
B. 38 ft
C. 113 ft
D. 452 ft

Answers

Circumference = 2πr;
r = 6 ft. => C = 2π • 6 ≈ 37.7 ≈ 38 ft.
Answer: B 38 ft.

Answer: Option B. 38 ft

Step-by-step explanation:

To find the circumference of a circle, we use the formula C = 2πr, where C represents the circumference, r represents the radius of the circle, and π (pi) is a mathematical constant that is approximately equal to 3.14.

In this problem, we are given that the radius of the circular pool is 6 ft. We can substitute this value into the formula to find the circumference:

C = 2πr

C = 2π(6)

C ≈ 37.7 ft

Therefore, the approximate circumference of the pool is 37.7 feet. This is closest to answer choice B, which is 38 ft.

Please help will give brainlest and special thanks

Answers

Answer:50.24 is the closest its really 50.26

Step-by-step explanation:

41.501÷4

Please help me,

Answers

Answer:

10

Step-by-step explanation:

Your answer could be 10 or 10.3

theta is a right angled triangle tan theta=24/43) work out the value of theta give your answer to 1 decimal place

Answers

Answer:

We know that tan(theta) = opposite/hypotenuse = 24/43.Using inverse tangent, we can find the angle theta:theta = tan^(-1)(24/43)Using a calculator, we can find:theta ≈ 29.6 degrees (rounded to 1 decimal place)Therefore, the value of theta to 1 decimal place is approximately 29.6 degrees.

Step-by-step explanation:

Final answer:

The value of theta in a right angle triangle for which tan(theta) = 24/43 can be found using the inverse tangent function, also known as arctan. When evaluated, theta equals approximately 29.4 degrees.

Explanation:

In trigonometry, the tangent of an angle in a right angle triangle is the ratio of the side opposite to the angle to the side adjacent to the angle. Here, tan(theta) = 24/43, which means the ratio of the opposite side to the adjacent side is 24/43. To find the angle 'theta', you will need to use the inverse tangent function, commonly known as arctan or tan^-1.

In this case, theta = arctan(24/43). Use a calculator and ensure it's set to give the answer in degrees, not radians. The answer would be approximately 29.4 degrees to 1 decimal place.

Learn more about trigonometry here:

https://brainly.com/question/31896723

#SPJ11

A water dispenser fills 4 glasses in 32 seconds. How many glasses will be filled by the dispenser in 128 seconds?
A. 8
B. 40
C. 16
D. 24

Answers

Answer: C

Step-by-step explanation:

32/4 = 8 ( the unit rate )

And then if you do 128/8 you get 16

Hi there so you put it as 4/32 and #/128 and so you do 128x4 and then divide it by 32 which then 16 is your answer

Please Help me! I am clueless

Answers

Firstly, you have to find the area of the whole shape. After that, you subtract that from the area of the individual triangle to get your answer.

The whole shape is a rectangle, with a length of 6 and a width of 7.
To find the area, multiply 6 by 7=42yd^2

The area of the entire shape is 42yd^2

Now, the vertical 4yd side plus the height of the dotted triangle will equal 6yd.
So the height of the dotted triangle is 6-4=2yd.

The horizontal 4yd side plus the base of the dotted triangle will equal 7yd.
So the base of the dotted triangle is 7-4=3yd.

Formula for area of triangle: 1/2 x base x height
1/2 x 4 x 3= 6yd^2

The area of the dotted triangle is 6yd^2

Now subtract the area of the whole shape by the area of the dotted triangle to get the shaded region.

42-6= 36yd^2

Area of shaded region: 36yd^2 (i think)

(so sorry if i’m wrong!!!)

39 yds squared
make into trapezoid and rectangle
rectangle 4*6=24
trapezoid (4+6/2)3=15
15+24=39

12(6) + 14 ⋅ 2 ⋅ 2 =

Answers

Answer: 128

Step-by-step explanation:

12(6)+ 14x2x2

Use PEMDAS

1.Do the parentheses-(These are parentheses) first

When the number it touching another number like this, you need to multiply them together

12x6=72

72+14x2x2

2. Then do exponents, but we don't have any so next to multiplying

2x2=4

72+14x4

14x4=56

3. Now we divide, but we don't have to divide anything so now we add

72+56=128

4. There is no subtraction in the problem, so now we are done and the total is 128

Have a good day =)

Angelica can ride her bike 30 miles in five hours. At this rate, how many miles will angelica ride in 3 hours?

Answers

Explanation:

30/5=6

6*3=18

Therefore, she can ride approximately 18 miles in 3 hours.

"Pure mathematics is, in its way, the poetry of logical ideas" -Albert Einstein

18 miles since that is how many miles she can ride in 3 hours :)

whats an outlier in math

Answers

Answer:An outlier is a data point that lies outside the overall pattern in a distribution.

Step-by-step explanation:

An example would be a data set like (4,5,4,5,5,5,345) 345 would be the outlier in that scenario

a number or piece of data that is not normal and stands out

What is the product of −8 1/3 and 3 2/5?
Possible Responses

−28 1/3
Negative 28 and 1 third

−24 2/15
Negative 24 and 2 over 15

24 2/15
24 and 2 over 15

28 1/3
28 and 1 third

Show work please!
How did you do it?
Step-By-Step

Answers

Answer: -28.3...

Step-by-step explanation:

steps:

-8 1/3 × 3 2/5
=
- 25/3 x 17

=
-25 × 17
—————
3 × 5
=
-425
———-
15
=
-425 ÷ 5
—————
15 ÷ 5
=
– 85
——-
3
=
–28 1/3

3 If you add another layer to figure B, what would the volume be? Explain.​

Answers

5 × 3 × 4 = 120 units³

now

120×2 = 240units³

Answer:

120×2 = 240units³ =)

Step-by-step explanation:

I need help with this as fast as possible please

Answers

to get a number you got to multiply ========2564

Im offering 10 points ( again )

Answers

Answer

Its D

Step-by-step explanation:

I graphed it and it lines up, trust me bro.

Please help!!

Which two points would a line of fit go through to best fit the data?


(3, 6) and (7, 3)

(3, 7) and (9, 1)

(1, 9) and (5, 7)

(1, 7) and (2, 5)

Answers

Answer:

  (a)  (3, 6) and (7, 3)

Step-by-step explanation:

You want the two points that best describe a line of best fit through the data shown on the given graph.

Line of best fit

A calculator finds the slope of the line of best fit to be about -0.74. The pair of points that best matches that is ...

  (3, 6) and (7, 3) . . . . choice A

The line through these points has a slope of -0.75 and is very close to the best-fit line. The attachment shows how the various point pairs relate to the computed line. The answer choice points are the larger red dots.

__

Additional comment

The slope of the line of best fit is the ratio of the covariance of x and y to the variance of x:

  m = cov(x, y)/var(x) = -7.744/10.455 ≈ -0.741

<95141404393>

Malika volunteers on the weekend at the Central Library. As a school project, she decides to record how many people visit the library, and where they go. On Saturday, 497 people went to The Youth Wing, 369 people went to Social Issues, and 416 went to Fiction and Literature.
On Sunday, the library had 1400 total visitors. Based on what Malika had recorded on Saturday, about how many people should be expected to go to The Youth Wing? Round your answer to the nearest whole number.

Answers

Answer:

397

Step-by-step explanation:

The answer is 397 Hope this works for 7

A diamond merchant received a shipment of 4 ⅔ pounds of diamonds. She divided the diamonds into 6 equal lots and sold them to jewelers for making rings and necklaces. What was the weight of the diamonds in each lot?

Answers

Answer:7/9 of a pound in each lot

Step-by-step explanation:4 2/3 = 14/3

14/3 divided by 6 will give us 14/18 which simplifies to 7/9

7/9 of a pound in each lot
Other Questions
Convert the following circuit using NAND Question 11(Multiple Choice Worth 2 points) (Line of Fit MC) A scatter plot is shown on the coordinate plane. scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4 Which of the following graphs shows a line on the scatter plot that fits the data? scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 2 comma 3 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 8 comma 4 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing close through the coordinates at about 2 comma 3 and 8 comma 5 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 3 and a half and 2 comma 3 and a half . let u = , v = . find u + v. (1 point)how to find find u+v? Approximately ____ percent of professionals working on virtual teams have never met their teammates in person, Mutiple Choice a 25 b 40 c 75 d 90 Lines AC and DB intersect at point W. Also, mDWC=138. PLEASE HELP TY What is the central idea of this poem?Women must be happy in order to enjoy protection.When protected, women experience total happiness.Religious customs, like the Pardah, lead tohappiness.No one, no matter how protected, can escape thesorrow in life. Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words Compare the similarities between Capitalism and Socialism. Garcia Co. Sells snowboards. Each snowboard requires direct materials of $112, direct labor of $42, and variable overhead of $57. The company expects fixed overhead costs of $659,000 and fixed selling and administrative costs of $125,000 for the next year. It expects to produce and sell 11,200 snowboards in the next year. What will be the selling price per unit if Garcia uses a markup of 10% of total cost find the next three terms in the sequence 3/4, 1/2, 1/4, 0 Acme corp. is a leading provider of radios to the commercial market. its products all rely on printed circuit-board technology. acme has protected its market leadership with continued advancements in this technology, which it patents. a competitor has developed a radio for this market with equal performance but uses a software-based technology instead of circuit boardsis acme's technology leadership(compeptitive advantage) sustainable? why/ why not (what capability tests does acme's technology leadership fail?) calculate the molality of a solition with 85 g of KOH added to 590. g of water The amount of uniformity in the size of rock or sediment particles is called find the distance between each pair of points. (5 1/2, -7 1/2) and (5 1/2, -1 1/2) The figure shows a 25-cm-long metal rod pulled along two frictionless, conducting rails at a constant speed of 3. 5 m/s. The rails have negligible resistance, but the rod has a resistance of 0. 65