Neil is creating a computer game in which bubbles represented by circles​ collide, merge, and separate in different ways. A bubble may be enclosed in a square whose side length is equal to the​ bubble's diameter. Four bubbles in squares collide and merge into one large bubble in a square. The area of the large bubble is equal to the sum of the areas of the small bubbles. How is the side length of the large square related to the side length of the small​ square?

Answers

Answer 1

the side length of the large square is equal to 4 divided by the square root of π times the side length of the small square.

what is length  ?

Length is a physical quantity that refers to the measurement of a one-dimensional distance or extent, such as the distance between two points. It is typically measured in units such as meters, feet, inches, or centimeters. Length can be used to describe the size or dimensions

In the given question,

Let's assume that the side length of the small square is equal to the diameter of each small bubble.

When four bubbles in squares collide and merge into one large bubble in a square, the total area of the small squares is equal to the area of the large square. Since the side length of each small square is equal to the diameter of the small bubble, the area of each small square is equal to the square of the diameter of the small bubble.

So, if we let d be the diameter of each small bubble, then the area of each small square is equal to d². Therefore, the total area of the four small squares is equal to 4d², and the area of the large square is equal to the sum of the areas of the four small squares, which is 4d².

The area of a circle is equal to πr², where r is the radius of the circle. If we let R be the radius of the large bubble, then its area is equal to π².

We know that the area of the large square is equal to the area of the large bubble, so we have:

4d² = πR²

Solving for R, we get:

R =√(4d²/π)

R = 2d/√(π)

Since the side length of the large square is equal to twice the radius of the large bubble, we have:

Side length of large square = 2R = 4d/√(π)

Therefore, the side length of the large square is equal to 4 divided by the square root of π times the side length of the small square.

To know more about length  , visit:

https://brainly.com/question/8552546

#SPJ1


Related Questions

Calculate the slope of the curve y = x2 at the point (3,9) and the slope of the curve
x = y? at the point (9,3). There is a simple relationship between the answers, which could have been anticipated (perhaps by looking at the graphs themselves). Explain. Illustrate
the same principle with two more points on these curves, this time using a second-quadrant
point on y = x2

Answers

This relationship between slopes can be explained by the fact that the curves y = x^2 and x = y are perpendicular to each other.

To calculate the slope of the curve y = x^2 at the point (3,9), we need to take the derivative of the equation with respect to x. This gives us y' = 2x. At the point (3,9), the slope would be y'(3) = 2(3) = 6.

To calculate the slope of the curve x = y at the point (9,3), we need to rewrite the equation in terms of y. This gives us y = x, and taking the derivative of y with respect to x gives us y' = 1. So the slope at the point (9,3) would be y'(9) = 1.

The simple relationship between these answers is that they are reciprocals of each other. The slope of the curve y = x^2 at a certain point is the inverse of the slope of the curve x = y at the same point.

To illustrate this principle with two more points on these curves, let's choose a second-quadrant point on y = x^2, such as (-2,4), and a corresponding point on x = y, which would be (4,-2).

At the point (-2,4) on y = x^2, the slope would be y'(-2) = 2(-2) = -4. At the corresponding point (4,-2) on x = y, the slope would be y'(4) = 1. Again, we can see that these slopes are reciprocals of each other.

This means that the slopes of the tangent lines at any two intersecting points will always be reciprocals of each other.

To learn more about derivative click here

brainly.com/question/25324584

#SPJ11

Solve for This and please provide step by step on how to do it please

Answers

The equation [tex]\frac{y+6}{y-1}+\frac{y-4}{y^2-y} = \frac{1}{y-1}[/tex] when solved for y is -3 ± √13

Calculating the equation for y

From the question, we have the following parameters that can be used in our computation:

[tex]\frac{y+6}{y-1}+\frac{y-4}{y^2-y} = \frac{1}{y-1}[/tex]

Simplify the denominators

So, we have

[tex]\frac{y+6}{y-1}+\frac{y-4}{y(y-1)} = \frac{1}{y-1}[/tex]

This gives

y + 6 + (y - 4)/y = 1

Subtract 1 from both sides

y + 5 + (y - 4)/y = 0

So, we have

y² + 5y + y - 4 = 0

Evaluate

y² + 6y - 4 = 0

When solved, we have

[tex]y = \frac{-b \pm \sqrt{b^2 -4ac} }{2a}[/tex]

So, we have

[tex]y = \frac{-6 \pm \sqrt{6^2 -4(1)(-4)} }{2(1)}[/tex]

Evaluate

[tex]y = \frac{-6 \pm \sqrt{52} }{2}[/tex]

Evaluate

[tex]y = -3 \pm \sqrt{13}[/tex]

Hence, the solution is -3 ± √13

Read more about equations at

https://brainly.com/question/148035

#SPJ1

Cathy works at a restaurant. On Monday, she served 9 tables with 6 people at each table. On Tuesday, she served 86 people. She wants to know how many more people she served on Tuesday than on Monday.



Select the correct operations from the drop-down menus to represent this problem using equations.



9


Choose.


6 = m



86


Choose.


54 = d

Answers

Cathy served 32 more people on Tuesday than on Monday.

Given, on Monday, Cathy served 9 tables with 6 people at each table. On Tuesday, Cathy served 86 people. We have to find the number of people she served more on Tuesday than on Monday.

So, on Monday she served = 9 tables x 6 people per table

= 54 people.

To find out how many more people Cathy served on Tuesday than on Monday, we can subtract the number of people served on Monday from the number served on Tuesday.

i.e. 86 - 54 = 32.

Therefore, Cathy served 32 more people on Tuesday than on Monday.

Learn more about arithmetic problem here

https://brainly.com/question/29253083

#SPJ4

Mr. ross needed a box for his tools. he knew that the box had to be between 100 cubic inches and 150 cubic inches. which dimension shows the tool he can use

Answers

Mr. Ross can choose any dimensions for the length, width, and height as long as their product falls within the given volume range of 4 * 5 * 5 to 6 * 5 * 5 cubic inches.

To help you find the dimensions for Mr. Ross's tool box that can hold between 100 and 150 cubic inches, let's consider the following terms: volume, length, width, and height.

1. Volume: The space occupied by the tool box, which should be between 100 and 150 cubic inches.


2. Length, Width, and Height: The dimensions of the tool box that will determine its volume.

To find the dimensions for the tool box that meets Mr. Ross's requirements, we can use the formula for volume of a rectangular box:

Volume = Length × Width × Height

We need to find the Length, Width, and Height such that 100 ≤ Volume ≤ 150.

Unfortunately, without more specific information about the dimensions Mr. Ross prefers or the shape of the box, we cannot provide an exact set of dimensions. However, he can choose any dimensions for the length, width, and height as long as their product falls within the given volume range of 100 to 150 cubic inches.

To know more about dimensions refer here:

https://brainly.com/question/28688567

#SPJ11

A digital timer counts down from 5 minutes (5:00) to 0:00 one second at a time. For how many seconds does at least one of the three digits show a 2?

Answers

84 seconds
At seconds 2,12,22,32,42,and 52 of minutes 0,1,3,4 that is 24 seconds plus all 60 seconds of minute 2

The required answer is the total number of seconds in which at least one of the three digits shows a 2 is 10 + 20 = 30 seconds. In other words, during the countdown from 5 minutes to 0:00, there are 30 seconds in which at least one of the three digits shows a 2.

To determine the number of seconds in which at least one of the three digits on a digital timer shows a 2 while counting down from 5 minutes (5:00) to 0:00, we need to consider the various possibilities.

Step 1: Determine the total number of seconds in 5 minutes.

There are 60 seconds in a minute, so 5 minutes would be equal to 5 * 60 = 300 seconds.

Step 2: Consider each second from 0 to 300 and check if any of the three digits (hundreds, tens, or ones) contains the digit 2.

To simplify the calculation, we can focus on the ones digit for the first 60 seconds (from 0:00 to 0:59). In this range, the ones digit contains the digit 2 ten times (2, 12, 22, 32, 42, 52, 62, 72, 82, 92). So, in the first minute, there are 10 seconds in which the ones digit shows a 2.

For the remaining 240 seconds (from 1:00 to 4:59), we need to consider both the tens and ones digits. In each minute within this range, the tens digit can have a digit 2 for all ten seconds (20, 21, 22, ..., 29). Additionally, the ones digit can have a digit 2 for ten seconds in each minute. So, in the remaining 240 seconds, there are 10 * 2 = 20 seconds in which at least one of the tens or ones digits shows a 2.

Therefore, the total number of seconds in which at least one of the three digits shows a 2 is 10 + 20 = 30 seconds.

Hence, during the countdown from 5 minutes to 0:00, there are 30 seconds in which at least one of the three digits shows a 2.

Learn more about time conversions and digit counting at: [link]

https://brainly.com/question/32461447

#SPJ6

A measure of goodness of fit for the estimated regression equation is the.

Answers

A measure of goodness of fit for the estimated regression equation is the residual standard error (RSE)

It is a measure of goodness of fit for the estimated regression equation. It measures the average amount that the response variable (y) deviates from the estimated regression line, in the units of the response variable.

The RSE is calculated as the square root of the sum of squared residuals divided by the degrees of freedom. A smaller RSE indicates a better fit of the regression line to the data.

It represents the proportion of the variation in the dependent variable that is explained by the independent variable(s) in the model. The value of R-squared ranges from 0 to 1, with higher values indicating a better fit of the model to the data.

To know more about standard error:

https://brainly.com/question/14306566

#SPJ4

When he was 30, Kearney began investing $200 per month in various securities for his retirement savings. His investments averaged a 5. 5% annual rate of return until he retired at age 68. What was the value of Kearney's retirement savings when he retired? Assume monthly compounding of interest

Answers

To calculate the value of Kearney's retirement savings when he retired, we need to use the formula for compound interest:

A = P(1 + r/n)^(nt)

where:
A = final amount
P = initial principal (the amount Kearney invested each month)
r = annual interest rate (5.5%)
n = number of times interest is compounded per year (12, since we're assuming monthly compounding)
t = number of years

First, we need to calculate the total number of payments Kearney made into his retirement savings:

68 - 30 = 38 years

Since Kearney made monthly payments, the total number of payments is:

38 years x 12 months/year = 456 payments

Next, we need to calculate the value of each payment after it has earned interest. We can use the same formula as above, but with t = 1 (since we're calculating the value of one payment period):

P' = P(1 + r/n)^(nt)
P' = 200(1 + 0.055/12)^(12*1)
P' = 200(1.00458333333)^12
P' = 200(1.00458333333)^12
P' = 200(1.00458333333)^12
P' = 243.382740047

So each $200 payment is worth $243.38 after one month of earning interest.

Now we can use the formula for the future value of an annuity to calculate the total value of Kearney's retirement savings:

A = P'[(1 + r/n)^(nt) - 1]/(r/n)
A = 243.38[(1 + 0.055/12)^(12*38) - 1]/(0.055/12)
A = 243.38[1.93378208462 - 1]/(0.055/12)
A = 243.38[34.3478377249]
A = $8,351.53

Therefore, the value of Kearney's retirement savings when he retired was approximately $8,351.53.

Learn more about retirement savings at https://brainly.com/question/18187284

#SPJ11

When Kearney retired at age 68, the value of his retirement savings was $557,123.35.

To find the value of Kearney's retirement savings when he retired, we'll use the Future Value of an Annuity formula. Here are the given values and the formula:

Monthly investment (PMT) = $200

Annual interest rate (r) = 5.5% = 0.055

Monthly interest rate (i) = (1 + r)^(1/12) - 1 ≈ 0.004434

Number of years of investment (n) = 68 - 30 = 38 years

Number of months of investment (t) = 38 years * 12 months = 456 months

Future Value of Annuity (FV) formula:

FV = PMT * [(1 + i)^t - 1] / i

Now, we'll plug in the values and calculate the Future Value:

FV = 200 * [(1 + 0.004434)^456 - 1] / 0.004434

FV ≈ 200 * [12.2883] / 0.004434

FV ≈ 557123.35

The value of his retirement savings was approximately $557,123.35.

Learn more about Future value:

https://brainly.com/question/24703884

#SPJ11

Which equation best represents the line of best fit for the scatterplot?a) y = 2.5x + 25 b) y = −2.5x + 20 c) y = −0.05x + 20 d) y = −0.005x + 22.5

Answers

The equation of the line representing that best fit the given scatterplot is given by option d. y = -0.005x + 22.5.

Consider the two points from the attached scatterplot.

Let the coordinates of the two point be ( x₁ , y₁) = ( 1500 , 12.5 )

And other point be ( x₂ , y₂) = ( 2000 , 10 )

Slope of the line 'm'  = ( y₂ - y₁ ) / ( x₂ - x₁ )

                                  = ( 10 - 12.5) / ( 2000 - 1500 )

                                  = -2.5 / 500

                                  = -0.005

From the attached scatterplot we have,

y-intercept 'c' where x = 0 is equals to 22.5.

The equation best which represents the line of best fit for the scatterplot is equals to,

y = mx + c

Substitute the value we have,

y = -0.005x + 22.5

Therefore, the equation of the line representing scatterplot is equals to option d. y = -0.005x + 22.5.

Learn more about scatterplot here

brainly.com/question/27693650

#SPJ4

The above question is incomplete, the complete question is:

Which equation best represents the line of best fit for the scatterplot?

a) y = 2.5x + 25 b) y = −2.5x + 20 c) y = −0.05x + 20 d) y = −0.005x + 22.5

Attached scatterplot.

Find the area of the surface obtained by rotating the curve of parametric equations x = 6 cos^3 θ, y = 6sin^3 θ, 0 ≤ θ ≤ π/2

Answers

The area of the surface obtained by rotating the curve of parametric equations x = 6 cos^3 θ, y = 6sin^3 θ, 0 ≤ θ ≤ π/2 is 96π/5 square units.

To find the area of the surface obtained by rotating the curve of parametric equations x = 6 cos^3 θ, y = 6sin^3 θ, 0 ≤ θ ≤ π/2, we can use the formula for surface area of revolution:
A = 2π ∫_a^b f(x) √(1+(f'(x))^2) dx
In this case, we need to first find the function y = f(x) that represents the curve. Using the given parametric equations, we can eliminate θ to get:
x = 6 cos^3 θ
x = 6 (1-sin^2 θ) cos^2 θ
y = 6 sin^3 θ
y = 6 (1-x/6)^(3/2)

So the function that represents the curve is y = 6 (1-x/6)^(3/2). Now we can use the formula for surface area of revolution:
A = 2π ∫_0^6 (6 (1-x/6)^(3/2)) √(1+(-3/4 (1-x/6)^(-1/2))^2) dx
A = 2π ∫_0^6 (6 (1-x/6)^(3/2)) √(1+9/16 (1-x/6)^(-1)) dx
A = 2π ∫_0^6 (6 (1-x/6)^(3/2)) √((25-9x)/(16(1-x/6))) dx
This integral can be evaluated using substitution and partial fractions. The final answer is:
A = 96π/5

Therefore, the area of the surface obtained by rotating the curve of parametric equations x = 6 cos^3 θ, y = 6sin^3 θ, 0 ≤ θ ≤ π/2 is 96π/5 square units.

To learn more about parametric equations visit : https://brainly.com/question/30451972

#SPJ11

Jayce has a cylindrical dowel that she cuts in parallel to the base , What is the circumference of the horizontal cross section of the dowel rounded to the nearest whole number

Answers

If the dowel has a radius of 3.5 cm, we can round it to 4 cm and use the formula to find an estimated circumference of C ≈ 2π(4) ≈ 25.1 cm.

When Jayce cuts the cylindrical dowel in parallel to the base, she creates a circular cross section. The circumference of a circle is the distance around its perimeter, and it can be calculated using the formula C = 2πr, where C is the circumference, π is the mathematical constant pi (approximately 3.14), and r is the radius of the circle.

Since the dowel is cylindrical, its cross section will also be a circle. Therefore, to find the circumference of the horizontal cross section of the dowel, we need to know the radius of the circle.

However, we can estimate the circumference by rounding the radius to the nearest whole number. For example, if the dowel has a radius of 3.5 cm, we can round it to 4 cm and use the formula to find an estimated circumference of C ≈ 2π(4) ≈ 25.1 cm. Rounded to the nearest whole number, the circumference would be 25 cm.

In summary, to find the circumference of the horizontal cross section of a cylindrical dowel that has been cut in parallel to the base, we need to know the radius of the resulting circle. We can estimate the circumference by rounding the radius to the nearest whole number and using the formula C = 2πr.

To know more about circumference, refer to the link below:

https://brainly.com/question/26605972#

#SPJ11

To begin a bacteria study, a petri dish had 2700 bacteria cells. Each hour since, the number of cells has increased by 5. 2%.



Let t be the number of hours since the start of the study. Let y be the number of bacteria cells.



Write an exponential function showing the relationship between y and t.

Answers

The exponential function y = [tex]2700(1.02)^t[/tex] models the growth of bacteria cells in a petri dish over time, with an initial population of 2700 cells and a growth rate of 2% per hour.

Exponential functions are often used to model situations where the growth or decay of a quantity depends on a constant proportionality factor.

In this case, the proportionality factor is the growth rate, which is represented by the constant 0.02 in the function. The factor (1 + r) represents the growth factor, which is the multiplier for the initial population to calculate the population after t hours. The larger the growth rate, the faster the population will grow, and the steeper the graph of the exponential function will be.

The equation y = [tex]2700(1.02)^t[/tex] can be used to make predictions about the growth of the bacteria population over time. For example, after one hour, the number of bacteria cells would be y = [tex]2700(1.02)^1[/tex] = 2754 cells. After two hours, the number of cells would be y = [tex]2700(1.02)^2[/tex] = 2812 cells, and so on.

It's worth noting that exponential growth cannot continue indefinitely, as there are always limiting factors that will eventually constrain the growth of a population. In the case of bacteria, the petri dish may eventually become overcrowded or run out of nutrients, which will slow or stop the growth of the bacteria population. Therefore, the exponential function y = [tex]2700(1.02)^t[/tex] is a model that is only valid for a certain range of values of t, beyond which other factors may come into play.

To learn more about exponential function refer here:

https://brainly.com/question/14355665

#SPJ11

Find the area of the following shape. You must show all work to recive credit.

this is a writting question

Answers

The total area of the given figure is 12 units²

In the given figure, we have 3 shapes. One is rectangle and the other two are triangles. We can find areas of all three shapes and add to find the total area.

Finding area of the triangle ABC,

base of the triangle ABC = 4 units

height of the triangle ABC = 4 units

Area of the triangle ABC = 1/2 x base x height = 1/2 x 4 x 4 = 8 units²

Finding area of the triangle CDE,

base of the triangle CDE = 2 units

height of the triangle CDE = 2 units

Area of the triangle CDE = 1/2 x base x height = 1/2 x 2 x 2 = 2 units²

Finding area of the rectangle,

length of the rectangle = 2 units

breadth of the rectangle = 1 unit

Area of the rectangle = length x breadth = 2 x 1 = 2 units²

So, total area of the given figure = 8 units² + 2 units² + 2 units² = 12 units²

To know more about area,

https://brainly.com/question/21735282

#SPJ1

Kevin needs 2/3 of a yard to make a pillow. He has 3 1/3 yards of fabric. How many pillows can he make? A). 2 2/9 B. ) 3 2/3 C. ) 5 D. ) 6

Answers

The number of pillows requiring [tex]\frac{2}{3}[/tex] yards that can be made from [tex]3\frac{1}{3}[/tex] yards is 5. Thus the right answer to the given question is C.

Material required for making one pillow = [tex]\frac{2}{3}[/tex] yards

Total material = [tex]3\frac{1}{3}[/tex] yards

To find the number of pillows made we have to divide the material required for one pillow by the total material available to Kevin for making pillows

Number of pillows = [tex]3\frac{1}{3}[/tex] ÷ [tex]\frac{2}{3}[/tex]

=  [tex]\frac{10}{3}[/tex] ÷ [tex]\frac{2}{3}[/tex]

To divide two fractions, we take the reciprocal of the second number and multiply it by the first number.

=  [tex]\frac{10}{3}[/tex] * [tex]\frac{3}{2}[/tex]

= 5

Thus, the number of pillows made is 5.

Learn more about Division:

https://brainly.com/question/28722090

#SPJ4

1
(Lesson 8.2) Which statement about the graph of the rational function given is true? (1/2 point)
4. f(x) = 3*-7
x+2
A. The graph has no asymptotes.
B.
The graph has a vertical asymptote at x = -2.
C. The graph has a horizontal asymptote at y =
+

Answers

The statement about the graph of rational function which is true is option B.  that is "The graph has a vertical asymptote at x = -2

What is a rational function?

A rational function in mathematics is any function that can be described by a rational fraction, which is an algebraic fraction in which both the numerator and denominator are polynomials.

So the statement about the graph of the rational function indicated above is true, this is because the denominator of the rational function is (x+2), which equals zero when x=-2. Therefore, the function is undefined at x=-2 and the graph has a vertical asymptote at that point.

Learn more about vertical asymptote:
https://brainly.com/question/4084552
#SPJ1

Kay invests £1500 in an account paying 3% compound interest per year.


Neil invests £1500 in an account paying r% simple interest per year.



At the end of the 5th year, Kay and Neil’s account both contain the same amount of money



Calculate r.


Give your answer correct to 1 decimal place

Answers

The rate of interest that Neil gets, r%, comes out to be 3.18%

Compound interest is calculated as follows:

A = P[tex](1+r)^t[/tex]

where A is the amount

P is the principal

r is the rate of interest

t is the time

Simple interest can be calculated as:

A = P (1 + r * t)

where A is the amount

P is the principal

r is the rate of interest

t is the time

For Kay,

P = £1500

t = 5 years

r = 3% compound annually

A = 1500 [tex](1+0.03)^5[/tex]

= 1500 * [tex]1.03^5[/tex]

= £ 1,738.91

For Neil,

P = £1500

t = 5 years

r = r% simple interest

According to the question,

A = 1738.91

1500 ( 1 + r * 5) = 1738.91

1 + 5r = 1.159

5r = 0.159

r = 0.0318

r% = 3.18%

Learn more about Compound Interest:

https://brainly.com/question/30364118

#SPJ4

Evaluate the following expression:
−8−10×(−1)+7×(−1)
What order should be followed to solve this?

Answers

Answer:

To evaluate the expression −8−10×(−1)+7×(−1), you should follow the order of operations, which is often remembered by the acronym PEMDAS (Parentheses, Exponents, Multiplication and Division, Addition and Subtraction) 1. In this case, there are no parentheses or exponents, so we can proceed with multiplication and division, working from left to right.

1. Perform the multiplication operations:

−8−10×(−1)+7×(−1)=−8+10−7

2. Perform the addition and subtraction operations, working from left to right:

−8+10−7=2−7=−5

So, the value of the expression is −5.

if the spinner was spun 50 times and landed on 11 fifteen times, which statement is true?

Answers

Answer:

The last one.Because the experimental probability is 11 ÷ 50, which is 22%, and the theoretical probability is 1 ÷ 8, which is 12.5%

A right triangle with a height measuring
4.75 inches contains a hypotenuse
measuring 7.42 inches. What is the
measure of the area of the triangle to the
nearest tenth of a square inch?

Answers

The formula for the area of a right triangle is:

Area = (1/2) × base × height

We don't know the length of the base of the triangle, but we can use the Pythagorean theorem to find it:

base^2 + height^2 = hypotenuse^2

base^2 + 4.75^2 = 7.42^2

base^2 + 22.5625 = 55.0564

base^2 = 55.0564 - 22.5625

base^2 = 32.4939

base ≈ 5.7

Now we can use the formula for the area of a triangle to find the area:

Area = (1/2) × base × height

Area = (1/2) × 5.7 × 4.75

Area ≈ 13.5775

Rounding to the nearest tenth of a square inch, the measure of the area of the triangle is 13.6 square inches.

Find an equation of the circle drawn below.

Answers

Answer: x² + y²=6.25²

Step-by-step explanation:

Formula for a circle:

(x-h)²+(y-k)²=r²

where (h, k) is the center    yours: (0,0)

r is the raidus                                 r=6.25

Plug in:

x² + y²=6.25²

If θ is an angle in standard position whose terminal side passes through the point (4, 3), then tan2θ = _____.



3/2


24/7


7/24


21/32

Answers

To find the value of tan(θ), we first need to calculate the values of sine and cosine for the given point (4, 3) terminal side. We can use the Pythagorean theorem to find the length of the hypotenuse (r):

r = √((4)^2 + (3)^2) = √(16 + 9) = √25 = 5

Now, we can find sin(θ) and cos(θ) at the terminal side:

sin(θ) = opposite/hypotenuse = 3/5
cos(θ) = adjacent/hypotenuse = 4/5

Then, we can calculate tan(θ):

tan(θ) = sin(θ) / cos(θ) = (3/5) / (4/5) = 3/4

Now we need to find tan(2θ). We can use the double-angle formula for tangent:

tan(2θ) = (2 * tan(θ)) / (1 - tan^2(θ))

Substitute the value of tan(θ):

tan(2θ) = (2 * (3/4)) / (1 - (3/4)^2) = (3/2) / (1 - 9/16) = (3/2) / (7/16)

Now, we'll multiply by the reciprocal to solve for tan(2θ):

tan(2θ) = (3/2) * (16/7) = 24/7

So, tan2θ = 24/7. Your answer is: 24/7

Learn more about terminal side: https://brainly.com/question/31638217

#SPJ11

Which measurement is closest to the circumference of circumference of the parachute in feet

Answers

The closest measurement to the circumference of the parachute in feet is 78.54 feet. The calculation was done by multiplying the radius by 2π (the constant pi, approximately equal to 3.14), which gives the circumference of a circle is 78.54 feet.

The circumference of the parachute can be calculated using the formula

C = 2πr

where r is the radius of the parachute.

Given that the radius of the parachute is 12.5 feet, we can substitute this value in the formula and calculate the circumference

C = 2πr

C = 2π(12.5)

C ≈ 78.54 feet

Therefore, the circumference of the parachute is closest to 78.54 feet.

To know more about circumference:

https://brainly.com/question/28757341

#SPJ1

--The given question is incomplete, the complete question is given

" Which measurement is closest to the circumference of circumference of the parachute in feet if radius is 12.5.  "--

The figure 2 is dilated from figure 1. Find the scale factor.

Answers

Scale factor is 9/6 which simplifies to 3/2

What is the lateral area of the cone to the nearest whole number? The figure is not drawn to scale.
*
Captionless Image
34311 m^2
18918 m^2
15394 m^2
28742 m^2

Answers

The lateral area of the cone is 18918 m²

How to find the lateral area of the cone?

The lateral area of the cone can be determined using the formula:

A[tex]_{L}[/tex] = πrL

Where is the r is the radius of circular base of the cone and L is the slant height

In this case:

r = 140/2 = 70m

L = √(50² + 70²)   (Pythagoras theorem)

L = 10√74 m

A[tex]_{L}[/tex] = π * 70 * 10√74

A[tex]_{L}[/tex] = 18918 m²

Learn more about lateral area on:

https://brainly.com/question/12506372

#SPJ1

Aiden gave each member of his family a playlist of random songs to listen to and asked them to rate each song between 0 and 10. He compared his family’s ratings with the release year of each song and created the following scatterplot:

What would the linear equation be?

Answers

The linear equation from the given scatterplot will be y = -0.1x + 9.

On the given scatterplot we have the song released details on the x-axis and the average rating of the songs by the family members on the y-axis.

To get the linear equation from the given scatterplot we have to find the y-intercept of the equation.

The general form of the equation is y = mx + c

here, m is the slope and c is the y-intercept.

By, the given graph we can say that y is intercepting at the value '9'. So, the y-intercept is 9.

To find the slope we have to take two points,

Let's take two points as (1970, 7) and (1990, 5).

From the points slope = (5-7)/(1990-1970)

                                     = -2/20 = -1/10 = -0.1

So, the equation from the given scatterplot is y = mx+c

So, y = -0.1x + 9.

To know more about slopes,

https://brainly.com/question/3493733

#SPJ1

Mrs. Booth is trying to building a pool with the following dimensions:


4x^2 +15


8x^2 + 10


8x^2


The following polynomial represents the perimeter of the pool, ax^2 + bx + c. Find the values of a, b, and c that represent


the perimeter of the perimeter of the pool

Answers

The values of a, b, and c that represent the perimeter of the pool are a = 80, b = 0, and c = 100.

Step 1: Add the three dimensions together to find the total length of one side of the perimeter:
(4x^2 + 15) + (8x^2 + 10) + (8x^2) = 20x^2 + 25

Step 2: Since the perimeter has 4 equal sides (it's a rectangle), multiply the total length of one side by 4:
Perimeter = 4(20x^2 + 25) = 80x^2 + 100

Now, compare the perimeter polynomial with the general form ax^2 + bx + c:
80x^2 + 100 = ax^2 + bx + c

From this comparison, you can see that:
a = 80
b = 0 (since there is no term with x)
c = 100

So, the values of a, b, and c that represent the perimeter of the pool are a = 80, b = 0, and c = 100.

learn more about "Perimeter":-https://brainly.com/question/24571594

#SPJ11

List the defining attributes of each 3-D figure. Then name the figure.

Answers

Vertices faces and edges are only a few of the many attributes of three-dimensional shapes. The 3D shapes' faces are their flat exteriors. An edge is the section of a line where two faces converge.

List out the attributes of 3-D figures.

1) cube

A vertex is the intersection of three edges. A solid or three-dimensional form with six square faces is called a cube. These are the characteristics of the cube.

Every edge is equal.

8 vertex

6 faces  

12 edges

2) Cuboid

When the faces of a cuboid are rectangular, it is often referred to as a rectangular prism. The angles are all 90 degrees each. It has a cuboid.

8 vertex

6 faces

12 edges

3) Prism

A prism is a three-dimensional form with two equal ends, flat faces, and identical sides.l cross-section down the length of it. The prism is typically referred to as a triangular prism since its cross-section resembles a triangle. There is no bend to the prism. A prism has also

6 vertex

9 edges

2 triangles and 3 rectangles

5 faces.

4) Pyramid

A pyramid is a solid object with triangle exterior faces that converge at a single point at its summit. The base of the pyramid may be triangular, square, quadrilateral, or any other polygonal shape. The square pyramid, which has a square base and four triangular faces, is the type of pyramid that is most frequently employed. Take a look at a square pyramid.

5 vertices

5 faces

8 edges

5) Cylinder

The term "cylinder" refers to a three-dimensional geometrical shape.two circular bases joined by a curving surface make up this figure. In a cylinder,

no vertex

2 edges

2 circles on flat faces

one curving face

6) Cone

A cone is a three-dimensional thing or solid with a single vertex and a circular base. A geometric shape known as a cone has a smooth downward slope from its flat, circular base to its top point or apex. In a cone

one vertex

1 edge

1 circle with a flat face.

one curving face

7) Sphere

A sphere is a perfectly round, three-dimensional solid figure, and every point on its surface is equally spaced from the point, which is known as the center. The radius of the sphere is the predetermined distance from the sphere's center.

a sphere is

zero vertex

zero edges

one curving face

Learn more about cube here:

https://brainly.com/question/30962206

#SPJ1

For the week, Castle Manufacturing has a beginning cash balance of 100,000. They spend 99,000 on direct materials, 19,000 on direct labor, and 29,000 on manufacturing overhead. They also have cash sales of 10,000, accounts receivable collections of 220,000 and asset sales of 30,000. They also purchased assets in the amount of 20,000 and had sales commissions and other administrative expenses in the amount of 40,000. What was Castle Manufacturing cash balance at the end of the week?

Answers

Castle Manufacturing's cash balance at the end of the week would be $153,000.

To determine the cash balance, we must consider the beginning cash balance, cash inflows and cash outflows.

Beginning cash balance: $100,000
Cash inflows:
- Cash sales: $10,000
- Accounts receivable collections: $220,000
- Asset sales: $30,000
Total cash inflows: $260,000

Cash outflows:
- Direct materials: $99,000
- Direct labor: $19,000
- Manufacturing overhead: $29,000
- Purchase of assets: $20,000
- Sales commissions and administrative expenses: $40,000
Total cash outflows: $207,000

Ending cash balance: Beginning cash balance + Total cash inflows - Total cash outflows
= $100,000 + $260,000 - $207,000
= $153,000

Therefore, Castle Manufacturing's cash balance at the end of the week would be $153,000.

Learn more about cash balance here: https://brainly.com/question/29036415

#SPJ11

A toy train set has a circular track piece. The inner radius of the piece is 6 cm. One sector of the track has an arc length of 33 cm on the inside and 55 cm on the outside. What is the width of the track? *respost since people thought it would be funny to troll on my last. :/

Answers

The width of the toy train track is 4 cm.

To find the width of the toy train track, we need to consider the inner radius, the arc length of the inner sector, and the arc length of the outer sector.

Given:
Inner radius (r1) = 6 cm
Inner arc length (s1) = 33 cm
Outer arc length (s2) = 55 cm

Step 1: Find the central angle (θ) using the inner arc length and inner radius.
θ = s1/r1 = 33 cm / 6 cm = 5.5 radians

Step 2: Find the outer radius (r2) using the central angle and the outer arc length.
s2 = r2 × θ
55 cm = r2 × 5.5 radians
r2 = 55 cm / 5.5 radians = 10 cm

Step 3: Calculate the width of the track.
Width = Outer radius - Inner radius
Width = r2 - r1 = 10 cm - 6 cm = 4 cm

The width of the toy train track is 4 cm.

To know more about toy train track refer here:

https://brainly.com/question/15187533

#SPJ11

The world's population can be projected using the following exponential growth

model. using this function, a= pert, at the start of the year 2022, the world's

population will be around 7. 95 billion. the current growth rate is 1. 8%. in what

year would you expect the world's population to exceed 10 billion?

Answers

We can expect the world's population to exceed 10 billion around the year 2038, based on the given growth rate and exponential growth model.

Using the exponential growth model, the world's population (P) can be projected with the formula P = P0 * e^(rt), where P0 represents the initial population, r is the growth rate, t is time in years, and e is the base of the natural logarithm (approximately 2.718).

In this case, the initial population (P0) at the start of 2022 is 7.95 billion, and the current growth rate (r) is 1.8%, or 0.018 in decimal form.

To estimate when the population will exceed 10 billion, we can rearrange the formula as follows: t = ln(P/P0) / r. We want to find the year (t) when the population (P) surpasses 10 billion.

By plugging in the values, we get: t = ln(10/7.95) / 0.018. Calculating this, t ≈ 15.96 years.

Since we're starting from 2022, we need to add this value to the initial year: 2022 + 15.96 ≈ 2038.

You can learn more about the population at: brainly.com/question/27991860

#SPJ11

We would expect the world's population to exceed 10 billion in the year 2036 (2022 + 14.6).

How to find the  growth population?

The exponential growth model is given by:

P(t) = P0 * [tex]e^(^r^t^)[/tex]

where P0 is the initial population, r is the annual growth rate as a decimal, and t is the time in years.

From the problem, we know that:

P0 = 7.95 billion

r = 0.018 (1.8% as a decimal)

P(t) = 10 billion

We want to solve for t in the equation P(t) = 10 billion. Substituting in the values we know, we get:

10 billion = 7.95 billion *[tex]e^(0^.^0^1^8^t^)[/tex]

Dividing both sides by 7.95 billion, we get:

1.26 = [tex]e^(0^.^0^1^8^t^)[/tex]

Taking the natural logarithm of both sides, we get:

ln(1.26) = 0.018t

Solving for t, we get:

t = ln(1.26)/0.018

Using a calculator, we get:

t ≈ 14.6 years

So, we would expect the world's population to exceed 10 billion in the year 2036 (2022 + 14.6).

Learn more about  population growth

brainly.com/question/18415071

#SPJ11

Adcb is a rectangle. ac = 16 and bd = 2x + 4, find the value of x.

Answers

In a rectangle, the diagonals are equal in length. So we can write the equation: AC = BD or 16 = 2x + 4. Solving for x, we get x = 6.

Other Questions
. let u = , v = . find u + v. (1 point)how to find find u+v? Approximately ____ percent of professionals working on virtual teams have never met their teammates in person, Mutiple Choice a 25 b 40 c 75 d 90 Lines AC and DB intersect at point W. Also, mDWC=138. PLEASE HELP TY What is the central idea of this poem?Women must be happy in order to enjoy protection.When protected, women experience total happiness.Religious customs, like the Pardah, lead tohappiness.No one, no matter how protected, can escape thesorrow in life. Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words Compare the similarities between Capitalism and Socialism. Garcia Co. Sells snowboards. Each snowboard requires direct materials of $112, direct labor of $42, and variable overhead of $57. The company expects fixed overhead costs of $659,000 and fixed selling and administrative costs of $125,000 for the next year. It expects to produce and sell 11,200 snowboards in the next year. What will be the selling price per unit if Garcia uses a markup of 10% of total cost find the next three terms in the sequence 3/4, 1/2, 1/4, 0 Acme corp. is a leading provider of radios to the commercial market. its products all rely on printed circuit-board technology. acme has protected its market leadership with continued advancements in this technology, which it patents. a competitor has developed a radio for this market with equal performance but uses a software-based technology instead of circuit boardsis acme's technology leadership(compeptitive advantage) sustainable? why/ why not (what capability tests does acme's technology leadership fail?) calculate the molality of a solition with 85 g of KOH added to 590. g of water The amount of uniformity in the size of rock or sediment particles is called find the distance between each pair of points. (5 1/2, -7 1/2) and (5 1/2, -1 1/2) The figure shows a 25-cm-long metal rod pulled along two frictionless, conducting rails at a constant speed of 3. 5 m/s. The rails have negligible resistance, but the rod has a resistance of 0. 65 The Preamble includes the phrase "to form a more perfect union." Why is this reason listed for creating a new Constitution? A. because the people believed that the British had been unfair rulers B. because the United States would unite all of North America under one government C. because the government under the Articles of Confederation had not been effective D. because the new government was meant to be ruled by the people Christine has 5 coloured sweets in a bag. 1 of the sweets are red and 4 are green. She removes a sweet at random from the bag, notes the colour, and does not replace the sweet in the bag. She then chooses a second sweet at random. P(double green) P(Red | green) P( ) P(Green)