"Liberty Leading the People" by Eugène Delacroix is a powerful artwork that captures the spirit of revolution through its intense brushstrokes and dramatic composition.
In 1830, Delacroix was inspired by the July Revolution in France and created "Liberty Leading the People" as a celebration of the triumph of the people over tyranny. The painting depicts the allegorical figure of Liberty leading a diverse group of people forward, with a French tricolor flag waving behind them.
Delacroix's use of intense brushstrokes and vibrant colors gives the painting a sense of urgency and dynamism, while the dramatic composition captures the chaos and energy of the revolution. The painting has become an iconic representation of the French Revolution and a symbol of liberty and freedom.
Learn More about liberty and freedom
https://brainly.com/question/14519936
#SPJ4
Complete Question:
Discuss Liberty Leading the peopleEugène Delacroix. 1830 C.E. Oil on canvasDelacroix wanted to paint July 28: Liberty Leading the People to take his own special action in the revolution and his color technique combined his intense brushstrokes to create an unforgettable canvas.
how did the erie canal affect the american industrial revolution?
Answer: helped facilitate access to coal reserves in Pennsylvania, reducing American dependence on imported coal
Explanation:
37) The border between Germany and Poland established after World War II
The border between Germany and Poland established after World War II, known as the Oder-Neisse Line, was an outcome of the Potsdam Conference held in 1945.
The conference was attended by the leaders of the Allied Powers, including the United States, the United Kingdom, and the Soviet Union, to determine the future of Germany and its territories.
At the Potsdam Conference, it was decided that Germany would be divided into four occupation zones, and its eastern territories would be ceded to Poland and the Soviet Union. The Oder-Neisse Line, named after the two rivers Oder (Odra) and Neisse (Nysa), was proposed as the new border between Germany and Poland. This border shift aimed to compensate Poland for its territorial losses to the Soviet Union in the east.
The Oder-Neisse Line was a contentious issue, as it resulted in the displacement of millions of Germans living in the territories given to Poland. The new border was initially a provisional one, and it wasn't until the 1970 Treaty of Warsaw between West Germany and Poland that it was officially recognized. Finally, with the reunification of Germany in 1990, the border was confirmed as permanent in the German-Polish Border Treaty.
In summary, the Oder-Neisse Line established the border between Germany and Poland after World War II, following the decisions made at the Potsdam Conference. It remains the border between the two countries to this day, after being officially recognized in multiple treaties.
For more about World War II:
https://brainly.com/question/13382356
#SPJ11
Why is Tony Taylor upset at Lige Moss during the party celebrating the store's grand opening?
Tony Taylor is mad because Lige Moss interrupts "the one speech of his lifetime," which was being made to welcome the Starks couple to Eatonville.
Their Eyes Was on God is a 1937 novel by American author Zora Neale Hurston. It is considered a classic of the Harlem Renaissance and is Heston's most famous work. The novel explores the transformation of Jenny Crawford's protagonist "from a young but quiet woman to a woman who touches her own destiny". The response in south-central Florida in the early 20th century was initially negative. However, it is thought to have influenced African-American literature and women's literature since the end of the 20th century.
To know more about Harlem Renaissance click on the link below.
https://brainly.com/question/9195022
#SPJ4
TRUE OR FALSE 86) Colonialism is an effort by one country to establish settlements and impose its political, economic, and cultural principles on an alien people.
The given statement "colonialism is an effort by one country to establish settlements and impose its political, economic, and cultural principles on an alien people" is true, because it results in the loss of native culture and political autonomy, while benefiting the colonization of country economically.
This practice has been historically prevalent, with countries expanding their territories by establishing colonies in other regions. The colonizing country often seeks to exploit the resources of the colonized region, while also imposing their political system, economic structure, and cultural values upon the local population.
Colonialism often involves the suppression of the native culture and the promotion of the colonizer's culture. This can result in significant changes to the social and political structures of the colonized society.
The colonizing country typically benefits economically from the exploitation of resources and labor, while the colonized people may face long-term disadvantages due to the loss of sovereignty and self-determination.
In summary, the statement is true: colonialism is the process by which one country seeks to establish settlements in another region and impose its political, economic, and cultural principles on the native people.
This practice has had profound and lasting effects on the societies involved, often resulting in the loss of native culture and political autonomy, while benefiting the colonization of country economically.
To know more about colonization, refer here:
https://brainly.com/question/30764395#
#SPJ11
What can you tell me about the context and the style of Repos d'amour?
"Repos d'amour" is a painting by the French Rococo artist Jean-Honoré Fragonard, created around 1771-1773. The painting depicts a young couple resting in a landscape, surrounded by lush vegetation and flowers.
In terms of style, "Repos d'amour" is a quintessential example of the Rococo style. Rococo is characterized by its ornate and playful decorations, as well as its light and delicate brushwork.
The style emerged in France in the early 18th century, and was associated with the French court and aristocracy.
"Repos d'amour" is notable for its use of pastel colors and soft brushwork, which create a dreamy and romantic atmosphere.
The landscape is depicted in a hazy and almost abstract manner, with the emphasis placed on the couple in the foreground.
The woman is shown lying on her back, with her head resting on her lover's lap, while he leans over her and gazes down at her.
In terms of context, "Repos d'amour" was created during a time of great political and social upheaval in France. The painting was created just a few years before the French Revolution, which would overthrow the French monarchy and transform French society.
The Rococo style, which had been associated with the French court and aristocracy, would fall out of favor during the Revolution, as the new regime favored a more austere and classical style.
Despite this, "Repos d'amour" remains a beloved example of the Rococo style, and continues to be admired for its beauty and charm.
to know more about French Rococo refer here:
https://brainly.com/question/28260986#
#SPJ11
What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily?
The one major advantage that permitted the little Portuguese armada to rule the Indian Sea militarily Their installed gun could overcome different boats and beachfront fortifications.
Europeans had found the subtle water course to the rewarding Indian Sea exchange organization. The Portuguese technique in the Indian Sea was to overwhelm exchange using capability, terrorizing, and ruthlessness. their boats could outgun and outsmart contending maritime powers.
Their boats could outgun and outsmart contending maritime powers, while their installed cannons could annihilate beachfront fortresses. The point of Portugal in the Indian Sea was to guarantee the imposing business model of the flavor exchange.
Learn more about Portuguese:
https://brainly.com/question/31344706
#SPJ4
The Harappan Civilization was the first to build with what material?
Answer:
Harappan objects were made of stone, Shell, and metal. Copper and bronze were used to make tools, weapons, ornaments, and vessels. Gold and silver were used to make ornaments and vessels. Harappans also made stone seals.
even in the north which group was a regular part of commerce linking north american, africa, and europe? group of answer choices skilled craftsmen and shopkeepers sons of wealthy gentry university-trained puritans slaves and indentured servants
The group that played a regular part in commerce linking North America, Africa, and Europe, even in the North, was the "slaves and indentured servants." The correct option is slaves and indentured servants.
This group was an essential component of the transatlantic trade system known as the Triangular Trade. This system involved the trade of goods, raw materials, and people among the three continents. The main components of the Triangular Trade were the exchange of manufactured goods from Europe for enslaved people from Africa, who were then transported to North America and the Caribbean.
Though slavery and indentured servitude were more prevalent in the Southern regions of North America, they were still present in the North, contributing to the commercial success of the region. The Triangular Trade enabled merchants in the North to profit from the sale of goods and raw materials, fostering economic growth and development.
In summary, slaves and indentured servants played a significant role in commerce that linked North America, Africa, and Europe, even in the northern regions. They were an essential part of the Triangular Trade system, which facilitated economic growth and prosperity throughout the colonies. The correct option is slaves and indentured servants.
For more about indentured servants:
https://brainly.com/question/4850869
#SPJ11
Could Nietzsche be considered the philosopher of the “romantic hero”? If so, how so?
Friedrich Nietzsche was a German philosopher who was associated with the Romantic movement.
Nietzsche's importance as an irrationalist philosopher lay in that, while his early influences are to be found in Romanticism, he founded a modern irrationalism antithetical to that of the Romantics.
The works of Nietzsche can be divided into three distinct time periods. The Romantic worldview, influenced by Schopenhauer and Wagner, predominates in the early works.
Nietzsche frequently came to be identified with the Romantic movement in his later attempts to "cure himself" of all romanticism.
Yet, because of Nietzsche's own efforts to reveal romanticism's weaknesses, which became one of his main critical purposes beginning with his aphoristic phase, the less significant but more intriguing topic of whether he is a romantic has eclipsed the issue of his relationship to romanticism.
To know more about Nietzsche,
brainly.com/question/31227973
Economists call the constant ____ of the economy "creative destruction"
Economists refer to the constant transformation of the economy as creative destruction.
This concept was first introduced by Austrian economist Joseph Schumpeter in 1942. Creative destruction refers to the process through which innovative and technologically advanced ideas, products, and processes replace outdated ones, leading to economic growth and development.
In the context of the economy, creative destruction occurs when new technologies, products, or methods of production are introduced, making older ones obsolete. This process can result in the disappearance of certain industries or companies while creating new ones in their place.
Despite the potential negative impact on specific sectors or businesses, creative destruction is considered an essential driver of long-term economic growth and improved standards of living.
1. Innovation and technological advancements are introduced in the market.
2. These advancements lead to increased efficiency and productivity.
3. As a result, older technologies, products, or methods of production become obsolete and less competitive.
4. Companies and industries using the outdated technologies either adapt to the changes or face decline and potential closure.
5. New industries and companies emerge in response to the new technologies and market demands.
6. The process continues, constantly reshaping the economy and driving economic growth.
In conclusion, creative destruction is a vital aspect of a dynamic and evolving economy, ensuring continuous progress and development through the constant transformation of industries, products, and processes.
To know more about creative destruction, refer here:
https://brainly.com/question/28188575#
#SPJ11
They made farmers devote valuable land to cash crops like cotton and tried to compile subsistence farmers to modernize by charging them taxes What are the cons of colonial powers?
The cons of colonial powers include exploiting native resources, forcing cash crops on farmers, imposing taxes, subjugating the local population, erasing native culture and identity, and creating a legacy of inequality and instability.
Colonial powers often saw their colonies as sources of raw materials and labor to fuel their own economies. This resulted in the exploitation of native resources and people, with little regard for their welfare. Colonial powers also forced farmers to grow cash crops like cotton, which depleted the soil and reduced food security.
Furthermore, colonial powers imposed taxes on the local population, which often led to economic hardships and social unrest. The imposition of taxes was often part of an effort to modernize the local population and create a more efficient system of governance.
Finally, colonial powers eroded native culture and identity through policies of assimilation and cultural domination. This created a legacy of inequality and instability that still affects many former colonies today.
Learn More about colonial powers :
https://brainly.com/question/14447948
#SPJ4
Which Egyptian Royalty commissioned a Mortuary Temple Designed by Senmut?
The temple was commissioned by Hatshepsut. Its building was probably overseen by Senenmut, her trusted advisor who some researchers speculate may have also been her lover.
A mortuary temple constructed during the rule of Pharaoh Hatshepsut of Egypt's Eighteenth Dynasty is known as the Hatshepsut funerary temple. It is regarded as a marvel of ancient architecture and is situated across from the city of Luxor.
The whole construction pointed in the direction of the imposing Eighth Pylon, which Hatshepsut added to the Temple of Karnak as her most known work and from which the procession of participants of the Beautiful Festival of the Valley departed.
Learn more about Mortuary Temple here:
https://brainly.com/question/31182497
#SPJ4
How did the familiars of the Inquisition get answers from the people they questioned?
Answer questions 6, 7, and 8 below as well *
**PROVIDE CLEAR ANSWER**
WILL GIVE BRAINLIEST AS WELL
The familiars of the Inquisition get answers from the people by making their presence known, allowing locals the chance to confess their sins.
Confessions were punished with anything from a beating to a pilgrimage. Those who were suspected of heresy were made to testify.
This is the way they got answers from the people they questioned.
6. What happened to people in Spain who continued to practice Judaism?
- Jews, Muslims, and Protestants in Spain were forced into conversion, banished from Spain, or put to their end.
The Inquisition extended to further regions of Europe and the Americas. Hence, the people in Spain were treated cruelly.
7. How did Rifqa's family respond to inquisition ?
-In response to the Inquisition, Rifqa, her parents, and her brothers Nathan and Saul fled to Russia in an effort to join the three elder boys who had been residing in America.
8. You have learned about the history of Iberian Peninsula in multiple lessons. Using what you have learned, explain the major issues and the surrounding environment that created these issues. Be sure to include people, events and important dates in your explanation.
- Some major issues with Iberian peninsula are-
Iberia is one of the regions in Europe most likely to suffer severely from extreme climate change in industries that directly depend on precipitation and warmth, such agriculture and water supply.
- According to a case study, some of the issues that were highlighted were-
Water availability: By 2071-2100, it is expected that all scenarios in the Tagus River basin would result in a major decline in water availability, which will make it harder to comply with the Albufeira Convention on water sharing between Spain and Portugal.Energy accessibility: By the end of the century, hydropower generation may have decreased by 45–50%. The Segura River's water supply will be drastically reduced, and it won't be able to keep up with demand, especially under the more extreme climate change scenarios.Opportunities and threats: By changing reservoir management, implementing an environmentally conscious water management strategy, and significantly reducing the amount of water supplied to the Segura River transfer.Some major events that affected Iberia-
A Germanic invasion of the Iberian Peninsula in 406 included the Vandals, Swabians, and Alans, an Iranian-born non-Germanic group who had joined the Vandals. The invaders reached the west coast in less than two years.Iberia's history was dominated by Muslim rule from the early eighth century until the late fifteenth century, despite Christian attempts to retake governmental control of the peninsula. Early Portuguese growth was fueled by a stable monarchy by the fifteenth century. The union of Isabel and Fernando in Spain in 1479 was a crucial turning point in the creation of modern Spain. The contemporary states of Spain and Portugal are a result of those events. The first European state was Portugal.To know more about The Inquisition visit:
https://brainly.com/question/22445626
#SPJ1
What Alamo hero died beside the cannon at the back of the Alamo church?
why did violence flare up in the hudson river valley during the 1750s and 1760s? group of answer choices tenants challenged elite landlords over evictions. native americans burned settler homes over land issues. african american slaves confiscated white-owned plantations. the spanish royal government sent troops against british colonial tax evaders.
The reason violence flared up in the Hudson River Valley during the 1750s and 1760s was mainly due to tenants challenging elite landlords over evictions and Native Americans burning settler homes over land issues.
In the mid-18th century, tensions arose between tenant farmers and elite landlords in the Hudson River Valley. Landlords often held large tracts of land and leased them to tenant farmers, who were subject to high rents and strict contracts.
Many tenants felt exploited and began to challenge the landlords over evictions, leading to violence and unrest.
At the same time, Native Americans in the region were increasingly resentful of the continued expansion of European settlers into their territories.
As settlers encroached on Native American lands, tensions grew, and Native Americans began to burn settler homes in retaliation for land disputes. This contributed to the overall atmosphere of violence and conflict during this period.
The other options mentioned, such as African-American slaves confiscating white-owned plantations and the Spanish royal government sending troops against British colonial tax evaders, were not the primary causes of the violence in the Hudson River Valley during the 1750s and 1760s.
To know more about refer Hudson River Valley here
brainly.com/question/14035135#
#SPJ11
THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?
The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.
Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.
The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.
To know more about nucleotide sequence visit:
https://brainly.com/question/17105264
#SPJ4
In two sentences, explain why people support and oppose new voting rules that some state legislatures have made in the United States.
Thank you!! :)
why were many abolitionist groups an extension of the church
The reason why many abolitionist groups serves as an extension of the church was that some of the Enlightenment philosophers opposed slavery and most of them are Christian activists.
What was abolitionist groups?The groups can be described as the fragmented anti-slavery movement which were been set up so they can come against the act of slavery they some of the group which can be seen as the Liberty Party; the American as wellas the Foreign Anti-Slavery Society.
Itshould be noted that the American Missionary Association as wellas other group rised up so that they can come against this and some of them are Christian activists.
Learn more about abolitionist at:
https://brainly.com/question/1818846
#SPJ1
About how long did the Portuguese trading empire in the Indian Ocean flourish?
The Portuguese trading empire in the Indian Ocean flourishes in Less than a century.
The option (B) is correct.
Portugal's motivation in the Indian Sea was to guarantee the imposing business model of the zest exchange. Exploiting the contentions that set Hindus in opposition to Muslims, the Portuguese laid out a few fortresses and general stores. By 1600, the Portuguese general store realm started by Vasco da Gama in 1497 was at that point in steep downfall.
The Indian Ocean was the focal point of world exchange. A wide range of shipping lanes crossed its waves. These courses connected the South China Ocean to the Indian Sea to the Mediterranean Ocean.
Learn more about trading empire:
https://brainly.com/question/2574969
#SPJ4
This question is not complete, Here I am attaching the complete question:
About how long did the Portuguese trading empire in the Indian Ocean flourish?
a) Nearly four centuries
b) Less than a century
c) Less than 50 years
d) About two centuries
in 1890, the sherman anti-trust act was enacted. what was it's purpose, and how did it effect organized labor?
In 1890, the Sherman Anti-Trust Act was enacted. Its primary purpose was to regulate and prevent monopolistic practices by large corporations, as well as to promote economic competition. This legislation aimed to prohibit trusts, cartels, and other business arrangements that could potentially hinder fair competition within the marketplace.
The impact of the Sherman Anti-Trust Act on organized labor was significant. Initially, the Act was not only used to target big corporations, but it was also applied to labor unions. Courts often viewed unions as potential restraints on trade, as they could limit the supply of labor and drive up wages.
Consequently, unions were sometimes prosecuted under the Act, which led to the weakening of the labor movement during this period.
However, as the interpretation of the Sherman Anti-Trust Act evolved over time, its application to labor unions diminished. In 1914, the Clayton Antitrust Act was passed, which explicitly exempted labor unions from being considered as monopolies or illegal combinations.
This allowed organized labor to regain strength and continue advocating for better working conditions and wages for their members.
In conclusion, the Sherman Anti-Trust Act of 1890 was enacted to prevent monopolistic practices and promote competition. Initially, its impact on organized labor was negative, as unions were prosecuted under the Act.
However, with the passage of the Clayton Antitrust Act in 1914, unions were exempted from the law, allowing them to continue fighting for workers' rights.
To know more about monopolistic practices refer here
brainly.com/question/12652861#
#SPJ11
What did King Louis XVI of France offer the Americas?
King Louis XVI of France offered: significant financial and military support to the Americas during the American Revolutionary War.
In response to your question about what King Louis XVI of France offered the Americas, the key terms to consider are King Louis XVI, France, financial support, military support, and American Revolutionary War.
King Louis XVI saw an opportunity to weaken Britain, a rival nation, by assisting the American colonies in their struggle for independence. After the American victory at the Battle of Saratoga in 1777, France entered into a formal alliance with the Americans.
This alliance, known as the Treaty of Alliance, provided the colonists with vital financial support, as France loaned money and supplied weapons, ammunition, and uniforms to the American forces.
Additionally, France offered military support in the form of troops, ships, and experienced officers. One notable figure who served as a volunteer was the Marquis de Lafayette, who played a crucial role in the war as a key aide to General George Washington.
French naval forces, under the command of Admiral de Grasse, also played a decisive role in the American victory at the Battle of Yorktown in 1781.
In summary, King Louis XVI of France offered financial and military support to the Americas during the American Revolutionary War. This support was essential in helping the colonists achieve victory and ultimately secure their independence from Britain.
To know more about Revolutionary War, refer here:
brainly.com/question/22135298#
#SPJ11
How did the League of Nations respond to Japan's annex of Manchuria in 1931? What did Japan do?
Japan violated the League of Nations in 1931 when it invaded Manchuria.
The League's chief weapon, economic sanctions, was ineffective.
Japan, ruled by a reactionary Emperor under the influence of generals with expansionist ambitions, simply ignored the League's demand that it leave China and instead withdrew from the League.
TRUE OR FALSE : the Paleozoic Era is longer than the Neoproterozoic Era.
TRUE. The Paleozoic Era, which lasted from approximately 541 million years ago to 252 million years ago, is longer than the Neoproterozoic Era, which lasted from approximately 1 billion years ago to 541 million years ago.
The earliest of the three (3) geologic eras that made up the Phanerozoic era is referred to as the Paleozoic era.
Because it began 541 million years ago and concluded 252 million years ago, the Paleozoic era is widely regarded as the Phanerozoic era's longest geologic era. The Paleozoic era is divided into six geologic periods, which are given below in order of oldest to youngest:
between the beginning and conclusion of the Paleozoic era, the following events occurred;
Marine living organisms (phyla) were present throughout the Cambrian period of the Paleozoic era.There was volcanic activity during the Paleozoic era.Finally, the Paleozoic epoch was a time in geologic history when marine fossils were subject to erosion and deposition.Learn more about Paleozoic Era here
https://brainly.com/question/11614266
#SPJ11
When did cotton become a major export from America?
The combination of the invention of the cotton gin, the profitability of cotton, and the expansion of slavery in the southern states all contributed to the rise of cotton as a major export from America in the 19th century.
Cotton became a major export from America in the 19th century, particularly after the invention of the cotton gin in 1793 by Eli Whitney. The cotton gin made it much easier and faster to separate cotton fibers from their seeds, increasing the efficiency of cotton production and lowering its cost.
By the mid-19th century, the United States had become the world's largest producer and exporter of cotton, with the vast majority of the crop grown in the southern states. Cotton was in high demand, both domestically and internationally, and it played a significant role in the economy of the southern states.
Learn more about The cotton gin here:
https://brainly.com/question/8433181
#SPJ4
Why do you think the Quakers and others on the Underground Railroad provide shelter to the runaways?
A. They help for humanitarian and religious reasons.
B. They are Northerners who are against Southerners.
C. They like Harriet Tubman.
D. They wanted to gain political advantage in the North.
The Quakers and others on the Underground Railroad provided shelter to runaway slaves for (Option A) humanitarian and religious reasons, not for political gain or personal preferences.
The Quakers, a religious group that believed in the equality of all human beings, felt that it was their moral duty to help those who were oppressed and suffering.
Additionally, the Underground Railroad was not a political organization, but a network of people who were dedicated to helping slaves escape to freedom.
Those who participated in the Underground Railroad did so at great personal risk, as it was illegal to aid runaway slaves. Therefore, it is unlikely that they would have risked their safety for political gain or personal preferences.
Furthermore, the Underground Railroad was not solely operated by Northerners who were against Southerners. It was a network of people who shared a common goal of helping slaves escape to freedom.
While there were certainly individuals in the North who were against slavery and supported the abolitionist movement, the Underground Railroad was made up of people from all walks of life and from various regions of the country.
In conclusion, the Quakers and others on the Underground Railroad provided shelter to runaway slaves out of a sense of (Option A) humanitarianism and religious duty, not for political gain or personal preferences.
They believed in the equality of all human beings and were willing to risk their own safety to help those who were oppressed and suffering.
For more question on "Quakers" :
https://brainly.com/question/23938089
#SPJ11
Safety net programs include…
Which statement about Joan of Arc is true?
Responses
Option B is one that accurately describes Joan of Arc, she said that she had received command from God to lead French troops in combat with English invaders.
Who is Joan of Arc?Joan of Arc, also known as the Maid of Orleans, was a French national heroine who played a pivotal role during the Hundred Years' War between England and France. Born in 1412 in Domrémy, France, she claimed to have received visions from God instructing her to lead the French army to victory against the English. At the age of 17, she convinced the French Dauphin to allow her to lead the army and she subsequently won several key battles, including the lifting of the siege of Orleans. She was found guilty and burned at the stake in 1431, but was later exonerated by the Catholic Church and canonized as a saint in 1920.
Learn more about Joan of arc here,
brainly.com/question/497316
#SPJ1
Complete Question:
Which statement about Joan of Arc is true?
A. She was a Benedictine nun who predicted that France would fall to King Edward III.
B. She said that God had told her to lead French troops against the English invaders.
C. She was executed by King Charles of France for losing the Battle of Crecy.
D. She commanded English forces in a siege against the French city of Orléans.
What changes did Rabbani and his jurisdiction implement?
Rabbani and his jurisdiction implemented a number of changes during his time as President of Afghanistan from 1992-1996. One of the most significant changes was the implementation of Islamic law, or sharia, as the basis for the country's legal system.
This included the establishment of Islamic courts and the imposition of strict punishments for crimes such as theft and adultery. Rabbani also made efforts to modernize the country's infrastructure, including the construction of roads and schools.
He also worked to establish diplomatic relations with other countries, including Pakistan and Saudi Arabia. However, Rabbani's rule was marked by ongoing conflict and instability, as various factions vied for power and control over the country.
In 1996, the Taliban overthrew Rabbani's government and established their own regime based on a strict interpretation of Islamic law.
To know more about Afghanistan refer here:
https://brainly.com/question/12545768#
#SPJ11
8) How free were Americans (in particular, women, African-Americans, and Japanese-Americans) in the years before and during World War II? To answer this question, you should use the Four Freedoms—as defined by the President and Norman Rockwell—as the standard.
Many Japanese Americans were forced to live in poor, cramped circumstances with barbed wire fences around them and armed guards for many years.
Japanese Americans lost not only their homes, companies, property, and money but also their liberty, security, and fundamental liberties that are equally the property of all Americans. I have always held the opinion that great countries confront their most trying times head-on, learn from them, and become stronger as a consequence.
The imprisonment of Japanese Americans 80 years ago serves as a warning to us about the awful results we invite when we let racism, xenophobia, and other forms of bigotry thrive.
Learn more about Japanese Americans here:
https://brainly.com/question/14585867
#SPJ4
Poor U.S. households today are more likely to own a refrigerator, air-conditioner, and dishwasher than the ____ household was in 1970.
Poor U.S. households today are more likely to own a refrigerator, air-conditioner, and dishwasher than the average household was in 1970.
This is due to several factors including advances in technology, changes in consumer behavior, and government programs aimed at improving living conditions for low-income families. In the past few decades, appliances have become more affordable and energy-efficient, making them more accessible to lower-income households.
Additionally, changes in consumer behavior have led to a greater emphasis on home ownership and home improvement, which has resulted in more households investing in appliances that can improve their quality of life.
Finally, government programs like the Low-Income Home Energy Assistance Program (LIHEAP) and the Weatherization Assistance Program (WAP) have provided funding and resources for low-income households to upgrade their homes and appliances.
Overall, while poverty remains a major issue in the United States, the increasing availability of modern appliances has helped to improve the quality of life for many low-income households.
To know more about household, refer here:
https://brainly.com/question/30713586#
#SPJ11