Are the members of the third generation still carriers/affected by the trait? How many
percent are affected by the trait?​

Answers

Answer 1

Answer:

When a genetic disorder is diagnosed in a family, family members often want to know the likelihood that they or their children will develop the condition. This can be difficult to predict in some cases because many factors influence a person's chances of developing a genetic condition. One important factor is how the condition is inherited. For example:

Autosomal dominant inheritance: A person affected by an autosomal dominant disorder has a 50 percent chance of passing the mutated gene to each child. The chance that a child will not inherit the mutated gene is also 50 percent. However, in some cases an autosomal dominant disorder results from a new (de novo) mutation that occurs during the formation of egg or sperm cells or early in embryonic development. In these cases, the child's parents are unaffected, but the child may pass on the condition to his or her own children.


Related Questions

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

What does the brain stem do?

Answers

Help you out with anything you’re having trouble with

Answer:

It connects the rest of the brain to the spinal cord, which runs down your neck and back. The brain stem is in charge of all the functions your body needs to stay alive, like breathing air, digesting food, and circulating blood.

Explanation:

Neurons that respond to specific types of lines are examples of:
A. figure detectors.
B. top-down processors.
C. feature detectors.
D. figure processors.

Answers

Answer:

C

Explanation:

Neurons that respond to certain types of lines are examples of feature detectors found in Option C. Neurons are the monomeric units of the nervous system that play an important role in transmission.

   

What is the importance of the neuron?

The neuron is a unit in which the message is transmitted from the neuron to another neuron, and this can be done by either chemical signaling or by electric signaling. The neuron receives sensory stimuli from the sensory organ and transmits them to the spinal cord.

Later, the message from the spinal cord is sent to the motor organs, and the whole pathway of the neuron signaling from the sensory to the motor organ is called the reflex arc. The neuron takes part in the signaling process so that the muscle can function, regulate the contraction relaxation, and perform many other functions.

Hence, neurons that respond to certain types of lines are examples of feature detectors found in Option C.

Learn more about the neuron here.

https://brainly.com/question/29462317

#SPJ5

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

Answer fast please. !!!!!!!!!!!!!!!!!!A geologist who needs to curricula to rock formations in different areas can match exposed rock layers
true or false

Answers

Answer:

A geologist who needed to correlate two rock formations in different areas could match exposed rock layers? A geologist who needed to correlate two rock formations in different areas could match exposed rock layers. TRUE.Explanation:

Answer:

true

Explanation:

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

What is true about the insanity defense?

It is defined in the Diagnostic and Statistical Manual of Mental Disorders.
It can be used only if a person is diagnosed with a specific disorder from the DSM.
It is a legal term used to determine if a person can be held accountable for a crime.
It is a legal term that helps to determine if a person committed a crime or not.
It cannot be used if a person was previously found to be responsible for a different crime.

Answers

It is a legal term used to determine if a person can be held accountable for a crime

It's a legal term used to determine if a person can be held accountable for a crime. Hope this helps; have a wonderful day.

There is the picture to the question

Answers

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

Please help due in 10 minutes!
Explain how genetic drift of alleles in a small population- and- describe 2 real world examples of genetic drift (I.e. The Founder Effect and The Bottleneck Effect)

Answers

Answer:A small population is formed with a larger population.

Explanation:The population don’t represent the genetic diversity’s of the original

Population, and there smaller size mean they may experience strong drift of generations.

A dichotomouys key is used to identify a plant. 1a. Leaves are spiny ......................Pinus taeda 1b. Leaves are broad..................... Go to 2 2a. Single leaf..........................Go to 3 2b. Many leaves....................... Go to 4 3a. Leaf edge is smooth..............Cornus florida 3b. Lead edge is rough...............Ulmus americana 4a. Leaflet edges are smooth........Albizia julibrissin 4b. Leaflet edges are rough.........Juglans nigra A plant has many broad leaves with rough edges. What type of plant is this? (1 point)

albizia julibrissin
pinus taeda
cornus florida
juglans nigra

Answers

Answer:

juglans nigra

Explanation:

I did my research and its correct I finished the quiz

1 B

2 C

3 D

4 C

5 A

The plant identified by the dichotomous key is juglans nigra.

What is a dichotomous key?

A dichotomous key is a tool used to identify any plants and animals in the ecosystem.

They are identified by their morphological traits.

The key is made up of a set of paired assertions or clues about the qualities or attributes of the organisms.

It serves as a step-by-step guide to identifying each object.

Thus, the correct option is D, juglans nigra.

Learn more about the dichotomous key, here:

https://brainly.com/question/25244481

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

Drag the tiles to the correct boxes to complete the pairs.
Match the mRNA sequences to their DNA sequences.

Answers

1.) UUUUUAACG
2.) CCGAAAUGU
3.) AUUACGCAU
4.) GAUCAUUAC

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC
Other Questions
Describe Art Deco in 3 adjectivesDescribe Art Nouveau in 3 adjectives Hattie watched her mom scour the kitchen counter tops before racing to her bedroom and then to the bathroom. Jasmine asked in a curious voice, "Mom, what is going on?" "I'm running late and I can't find my sunglasses anywhere!" replied Jasmine's mom in total frustration. "The sunglasses that are on top of your head?" asked Jasmine. "Oh, my! Those are the ones! Thanks, sweetheart! answered Jasmine's mom. Jasmine shook her head and said to herself, "She has lost her marbles!"A.she is running lateB.she found her sunglassesC.she is losing her mindD.she also misplaced marbles The author includes several definitions of wellness in order to An isosceles triangle includes two 72angles. Which equation could be used tofind the measure of the third angle?A X + 72 = 180B X = 180 - 72C 72-X= 180D 180 - 2(72) = X A thermochemical equation indicates the absorption or release of heat in addition to the reactants and products involved in the chemical reaction. The amount of energy available for conversion into heat is represented by a triangle H does this term stand for? 11) Couples can best decide whether to become parents by ___.A. seriously discussing each other's goals before marriageB. seriously discussing each other's goals before marriage and playing with their petsC. playing with their petsD. playing with their pets and considering their relationship's strengthconsidering their relationship's strength12) One reason most individuals decide NOT to have children is ___.A. they want to choose the child's exact eye color, hair color, and genderB. they don't want their children embarrassing themC. they had wonderful childhoodsD. they have concerns about medical problems13) Taking fertility drugs may result in ___.A. multiple birthsB. baldnessC. in-vitro fertilizationD. sterility14) Which behaviors may teen mothers engage in during their first trimester of pregnancy because they do not know the risks or are unaware they are pregnant?A. none of theseB. drinkingC. drinking and taking drugsD. taking drugsE. smoking and taking drugsF. all of theseG. smoking help help help plz plz plz help today hi have to finish this and I have like 21 more assignments to go Which of the following has a negative charge?neutronselectronsnucleusprotons Sister chromatids are ____.. Single choice.A.dense patches within the nucleusB.bacterial chromosomesC.joined strands of duplicated genetic materialD.prokaryotic nucleiOption 2Please hellppppp! Yapn.............. Bir srpriz.. yardmc olur musunuz How is the rotation of the Sun different from the rotation of Earth?OThe parts of the Sun rotate at different speeds and the parts of Earth rotate at the same speed.O The Sun's equator rotates faster than its poles and Earth's equator rotates slower than its poles.O The Sun's poles rotate faster than its equator and Earth's poles rotate slower than its equator.O The parts of the Sun rotate in different directions and the parts of Earth all rotate in the same direction Giving Brainliest Solve for X In Linux, users are internally represented using a unique number called user ID or uid.a. Trueb. False What is programming? Only one of the comparisons below is correct. Which is correct? What benchmark was used in your answer?ANSWERS ARE:2/3 What is the first name of the singer in the interactive Vienna State Opera video? . Chris read 25 books in 135 days. At this rate, in how many days will he read another 5 books? Another 10 books? How many solutions does this equation have?10n + 8 = 3 + 10n which of these best describes a biome