who was the first pharoh of egypt

Answers

Answer 1

Answer:

Menes was the first pharaoh of egypt .

Please mark me as brainlist.

Answer 2
The First pharaoh was believe to be Narmer was also called Menes

Related Questions

How did the colonist react to the Boston Massacre

Answers

Answer:

Explanation:

The Boston Massacre had a major impact on relations between Britain and the American colonists. It further incensed colonists already weary of British rule and unfair taxation and roused them to fight for independence.

What are some similarities between 1930 and 2020

Answers

Answer:

The comparison and contrast economically between the 1920s and the 1930s is significant. It is a comparison between: embracing American Exceptionalism (1920s, Coolidge-Harding) and rejecting American Exceptionalism (1930s, Hoover-Roosevelt); an adherence to the Great Experiment (1920s, Coolidge-Harding) and a denunciation of the Great Experiment (1930s, Roosevelt-Hoover).

PLEASE ANSWER ASAP!! I will give brainliest!!! And 50 points!!!!

If you were an immigrant which part of "The New Colossus" would resonate with you?

Answers

Answer:

mother of exiles

...............................

PLEASE ANSWER ASAP!! I will give brainliest!!! And 50 points!!!!

If you were an immigrant which part of "The New Colossus" would resonate with you?

Who did John Winthrop command to “shut up or leave the colony” and they responded by comparing him to Pontius Pilate ?

Answers

Answer:

afRICAN PEOPLE. Copyright © 1997 by Paul Johnson.

All rights reserved. Printed in the United States of America. No part of

this book may be used or reproduced in any manner whatsoever without

written permission except in the case of brief quotations embodied in

critical articles and reviews. For information address HarperCollins

Publishers, Inc., 1o East 53rd Street, New York, NY ioozz.

HarperCollins books may be purchased for educational, business, or

sales promotional use. For information please write: Special Markets

Department, HarperCollins Publishers, Inc., 1o East 53rd Street,

Explanation:

In the government created by the Cherokee constitution, a single principal chief led the __________ branch.
A.
executive
B.
judicial
C.
legislative
D.
military


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

Option A - executive is your answer.

Answer: executive but I may be wrong

Explanation:

Now that you have learned more about this topic, indicate whether you agree or disagree with t
statement.
The most interesting jobs are those working with other people.
Agree. Disagree

Answers

Answer:

I agree........

Explanation:

I agree 'coz there will be laughter, interesting gists more friends, and helping hands.

Which sentence shows the best placement for the modifier “with the shaggy fur”?

A.With the shaggy fur, we laughed at the dog who was catching the ball.
B.We laughed at the dog who was catching the ball with the shaggy fur.
C.We laughed at the dog with the shaggy fur who was catching the ball.
D.Catching the ball, we laughed at the dog who was with the shaggy fur.


I NEED HELP FAST

Answers

Answer:

ctcyfygyfcyfyftf

Explanation:

cycycycyctctctxtxtxt

Answer:

it is C we laughed at the dog with shaggy fur who was catching a ball

HELPPPPP!!
Which comparisons about Governor Gálvez and Governor Miró are correct? Check all that apply.
They were both governor of Spanish Florida.
They were both governor of Spanish Louisiana.
They both led campaigns against the British.
They both helped rebuild the city of New Orleans.
They were both Spanish military leaders.

Answers

Answer:

B,C,E

I got this right on the quiz hopefully it helps.

Is the person who brings suit?
a. Defendant
b. Plaintiff
c. Attorney
d. Harry Stone

Answers

Defendant


hope this helps!

The goths and vandals were what kind of tribes

Answers

It’s the first one.....

What 4 groups of people had
territory established in North
America during the 1700s?

Answers

Answer:

Britain, France, Spain, and the Netherlands established colonies in North America.

In which area did the French find the most success
a shipbuilding
b fur trade
c agriculture
d lumber industry

Answers

Answer: It's (Fur Trade)

Explanation:

Agriculture is the best answer!

A military adventurer who starts or helps in revolutions in countries other than his own is called a ________________.
a.
filibuster
b.
mustanger
c.
convoy
d.
negotiator

Answers

A.) Fillibuster ! Hope this helps

Answer:

A. Filibuster

Explanation:

I took the test

How come Serbia was upset that Austria acquired Bosnia?

Answers

Answer:

By article 25 of the Treaty of Berlin, 1878, Austria-Hungary was permitted to occupy and administer Bosnia and Herzegovina. The crisis in 1908-1909 sprang from the fact that Serbia believed that she must prevent the consummation of annexation by Austria-Hungary or give up permanently her long-cherished hopes.

what was the significance of balboas discovery

Answers

Answer:

He discovered the Pacific Ocean.

Explanation:

He also claimed it for Spain and inspired Magellan to explore and find a sea route to the Pacific and East Indies.

Identify two things that the Andean States share, in addition to the mountains.

Answers

Answer:

The Andean states are defined as the collection of different nations present in South America that include Argentina, Bolivia , Chile, Colombia , Ecuador , Peru , and Venezuela all are connected by the Andes mountain range.

The Andean states share a lot of things along with mountain range including the Amazon rainforest,  Andes culture, and Amazonian indigenous people.

The "Andean States" share seven countries so they share the same Andes culture. Countries including Bolivia, Colombia, Ecuador, and Peru contains the Amazon rainforest.

Hence, the Andean states share more things along with the mountains.

How did steam locomotives lower the cost of transporting raw materials and finished goods?
A: They cost nothing to run because they ran on steam.
B: They could transport many materials or goods at once. √
C: They were uncomplicated and inexpensive to build.
D: They were safe and cut the chance of costly accidents.

Answers

Answer:

B: They could transport many materials or goods at once

Answer:

B

Explanation:

Carefully examine the map above. According to this map, New Zealand has a(n) __________ climate.

Answers

Answer:

Temperature. New Zealand has a largely temperate climate. While the far north has subtropical weather during summer, and inland alpine areas of the South Island can be as cold as – 10°C in winter, most of the country lies close to the coast, which means mild temperatures, moderate rainfall, and abundant sunshine.

Read the excerpt from Section 6 of the Interstate Commerce Act of 1887. Every common carrier subject to the provisions of this act shall print and keep for public inspection schedules showing the rates and fares and charges for the transportation of passengers and property which any such common carrier has established and which are in force at the time upon its railroad. A benefit of the Interstate Commerce Act to consumers is that the government will help pay for freight transportation by rail. railroads must clearly publish and honor posted schedules and fees. the government will require inspection of all passengers and freight. railroads may no longer transport goods across state lines.

Answers

Answer:

railroads must clearly publish and honor posted schedules and fees.

Explanation:

Answer:

railroads must clearly publish

Explanation:

Which statement best describes the relationship between the pope and the monarchs of Europe during the medieval
period?
The monarchs controlled the pope and the bishops.
They kept one another from gaining too much power.
O They helped one another maintain power over people.
O The pope controlled the flow of money for the monarchs.

Answers

Answer:

They helped one another maintain power over people.

Explanation:

Your Welcome;) Happy to help:)

Answer:

C) They helped one another maintain power over people.

Explanation:

I just got the question correct.

Hope this helps! ^^

When did the
civilization end?
(year)

Answers

Answer:

between 1900 and 1800 BCE.

Explanation:

Between 1800 and 19000

What is Trump’s breakthrough business venture and how does he pay for it?

Answers

Answer:

which one? he has had several

Explanation:

he hired people, made them work. then fired them before they got paid.

What is considered to be the highest court in the United States?
Supreme court
US district court
US court of appeals
military tribunal

Answers

Supreme Court is the highest court in USA

why is the battle of saratoga called the turning point of the revolutionary war?

A.british general cornwallis surrender at this battle

B.the spanish decide to become american allies

C.the french decide to become american allies

Answers

Answer:

C. the french decided to become american allies, after america convinced the french army of their strength. also neither spain or britain were even involved in this battle.

pls mark as brainliest

What was the purpose of the Sedition Act of 1798?

Answers

Answer: the government was trying to refine free speech

Explanation: In one of the first tests of freedom of speech, the House passed the Sedition Act, permitting the deportation, fine, or imprisonment of anyone deemed a threat or publishing “false, scandalous, or malicious writing” against the government of the United States.

The purpose of the Sedition Act of 1798 was to curb political opposition and suppress dissent during a time of international tension and domestic political divisions in the United States.

The Sedition Act was passed by the Federalist-controlled Congress and signed into law by President John Adams.

It was a response to the growing conflicts between the Federalists and the Democratic-Republicans, who were critical of the policies of the Adams administration, particularly its pro-British stance and its enactment of the Alien and Sedition Acts.

The Sedition Act was highly controversial and generated significant opposition. It played a significant role in the partisan tensions of the time and contributed to the decline of the Federalist Party's popularity.

Learn more about Sedition Act here:

brainly.com/question/14450818

#SPJ4

I will brainlist, please

Answers

agriculture i would say.

Kevin made a down payment of $1,500 for his car lease. His monthly payment amount is $200 for 36 months. What is the total cost of the lease, if the residual value is $8,000?
A.
$14,500
B.
$15,200
C.
$16,700

Answers

It’s B.


I’ve done this question before I remember

What did the Monroe Doctrine do?
A.It established an American protectorate over the Western Hemisphere.
B.It declared war on Spain because of Spain's colonization of South America.
C.It encourage European colonization of the Americas.
D.It formed an alliance between the United States and Britain.

Answers

Answer:

A- It established an American protectorate over the Western Hemisphere.

Explanation:

The Monroe Doctrine is the best known U.S. policy toward the Western Hemisphere. Buried in a routine annual message delivered to Congress by President James Monroe in December 1823, the doctrine warns European nations that the United States would not tolerate further colonization or puppet monarchs.

Hope this helps!

In what ways did slaves resist the dehumanization?

Answers

Breaking tools, feigning illness, staging slowdowns and sabotage..

What did social class look like in Haiti? What role did it play in Haiti's
freedom?

Answers

Answer:

Social class in Haiti uses a class structure that groups people according to wealth, income, education, type of occupation, and membership in a specific subculture or social network. Since colonial years, race has still played an important factor in determining social class.

Explanation:

Other Questions
HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer