What was the money in the coffee can that he will use for the trip to Johannesburg supposed to be used for?

Answers

Answer 1

In Cry, the Beloved Country, the money in the coffee can that Kumalo will use for the trip to Johannesburg is supposed to be used for their son's schooling.

Kumalo receives a letter and speculates as to its possible sender. It is a Johannesburg product. Among others, Kumalo's brother John, their sister Gertrude, and his son Absalom, who visited the city in quest of Gertrude and has never returned, all reside in Johannesburg. It is from a pastor in Johannesburg, who informs Kumalo that Gertrude is ill and asks him to travel to Sophiatown.

When Kumalo's wife inquires as to his plans, he regretfully instructs her to bring him the funds they had set aside for Absalom's tuition at St. Chad's, the neighbourhood school. Kumalo departs for Johannesburg after combining the St. Chad's funds with the rest of their resources.

Know more about Cry, the Beloved Country here

https://brainly.com/question/9177532

#SPJ4

The question seems incomplete. The complete question is:

In Cry, the Beloved Country, what was the money in the coffee can that Kumalo will use for the trip to Johannesburg supposed to be used for?


Related Questions

1. Know his/her place and duties
2. Don't bring dishonor on the family
3. Pay respect to dead ancestors
4. Provide support for any member who can't contribute

Answers

When family members or extended family members can trace their ancestry back to the same ancestors, this is referred to as Bilateral descent. The correct answer is 3.Pay respect to dead ancestors

In a system of close family relationships known as bilateral descent, the spouse and children at both the mother's and father's sides are equally important for maintaining emotional links and for the transfer of wealth or assets. It is a private circle of kinship where each family equally distributes ancestry and inheritance. refers to the relationships that are traditionally regarded as being within a person's own circle of relatives. Kinship serves as the cornerstone on which all societies build their social structures and categorise their members. However, there may be a significant amount of variation in kinship standards and practises.

To know more about Bilateral descent visit:

https://brainly.com/question/29182359

#SPJ4

What are (3) things the supervisor at each clinical site may do?

Answers

The supervisor at the clinic are responsible for various work that are discussed in the below section.

The Clinical Supervisor directs and manages an powerful medical carrier shipping crew the use of relevant ideas of Social Work and/or Counseling which include - affected person psychosocial assessment, organization and person psychotherapy, own circle of relatives intervention, affected person/own circle of relatives schooling and remedy planning. A supervisor's duties frequently include: Managing workflow. Training new hires. Creating and coping with crew schedules. Reporting to HR and senior management. Evaluating overall performance and imparting feedback. Identifying and making use of profession development opportunities. Helping to clear up worker troubles and disputes.

To learn more about supervisor check the link below-

https://brainly.com/question/29429866

#SPJ4

What is one transferable skill Daphne developed at her job as a dishwasher that helped her success in college? Explain.

Answers

One transferable skill Daphne developed at her job as a dishwasher that helped her success in college is time management.

What is management ?

Management is the process of planning, organizing, leading, and controlling resources in order to achieve desired goals and objectives. It involves the coordination and implementation of the four basic management functions: planning, organizing, leading, and controlling. Management also involves the development and implementation of strategies, processes, and systems to ensure the successful completion of tasks and the attainment of objectives. Management is essential to ensure that an organization runs smoothly and efficiently. Management involves the identification of problems, the development of solutions, and the implementation of those solutions.

To learn more about management

https://brainly.com/question/30628157

#SPJ1

true/false. Within the same culture the strategies used to reach rural areas easily transfer to urban areas
FALSE

Answers

The strategies used to reach rural areas are often different from those used to reach urban areas,  as the two environments present different challenges and opportunities. thus given statement is false.

In rural regions, for example, there might be a more noteworthy requirement for outreach through local area occasions and verbal, while in urban regions, computerized showcasing and virtual entertainment might be more compelling.

Moreover, the sorts of items and administrations that are popular may vary among urban and rural regions, requiring different advertising procedures. Accordingly, it is critical to foster designated approaches for every climate as opposed to accepting that one procedure will function admirably in both provincial and urban regions.

Learn more about rural areas:

https://brainly.com/question/16927480

#SPJ4

____ attitudes are an outcome of OB-related processes including leadership.

Answers

Positive attitudes are an outcome of OB-related processes, including leadership. Attitudes refer to an individual's positive or negative evaluation of an object, person, or situation.

Positive attitudes can lead to increased job satisfaction, organizational commitment, and job performance. On the other hand, negative attitudes can lead to decreased motivation, poor job performance, and higher turnover rates.

Organizational behavior (OB) is concerned with the study of how people interact within organizations. Leadership is an important aspect of OB-related processes, as leaders have the ability to influence employee attitudes through their behavior, communication style, and management practices.

Effective leadership can create a positive organizational culture that promotes trust, collaboration, and employee engagement. Leaders who are supportive, empowering, and provide opportunities for employee development can foster a sense of loyalty and commitment among employees. This, in turn, can lead to positive attitudes towards the organization and a desire to contribute to its success.

Thus, OB-related processes, including leadership, play a crucial role in shaping employee attitudes. Positive attitudes can result in numerous benefits for organizations, including increased productivity, reduced absenteeism, and improved retention rates.

Learn more about the Organizational behavior:

brainly.com/question/14499260

#SPJ4

If you wish to enter an express highway or freeway, you must _________ before merging with the traffic.
a. move to the acceleration lane
b. move to the exit ramp
c. move to the right-hand lane
d. reduce your speed

Answers

Before merging with the freeway's traffic, motorists in the acceleration lane accelerate to that speed. Give a signal and pick up the pace to merge with traffic without incident. Hence (b) is the correct option.

You must yield to any parked cars in that lane. To change lanes safely, slow down, check your mirrors and blind areas, and seek for a proper distance. You should be travelling at or close to the speed of the oncoming traffic when merging onto the motorway. It's acceptable if you move a little more slowly, but the goal is to prevent traffic congestion.

To know more about traffic, click here:

https://brainly.com/question/17017741

#SPJ4

meg is extremely creative when it comes to her development psychology course. her written assignments always demonstrate not only knowledge on the subject matter but also a unique perspective on the topic, originality, humor, and excellent writing skills. which quality does not help meg be creative?

Answers

Based on the information given, it seems that all of the qualities mentioned - knowledge on the subject matter, a unique perspective, originality, humor, and excellent writing skills - contribute to Meg's creativity in her development psychology course.

Therefore, there is no quality mentioned that does not help Meg be creative. In fact, all of these qualities are likely interrelated and contribute to each other, allowing Meg to approach her assignments in a creative and innovative way.

Excellent writing skills help Meg communicate her creativity effectively but do not contribute directly to her creative thinking process. In summary, creativity is fueled by knowledge, unique perspectives, originality, and humor, while excellent writing skills aid in expressing that creativity coherently.

To know more about writing skills visit:

https://brainly.com/question/19120658

#SPJ11

3 step procedure of acting well: the Kantian Perspective

Answers

The 3 step procedure of acting well from a Kantian perspective involves determining the moral rule or maxim, universalizing it to see if it can be applied to everyone, and then acting on it.

This means that actions must be based on a rational principle that can be applied universally, not simply based on personal desires or interests.

It emphasizes the importance of treating others as ends in themselves, rather than merely as means to an end. By following this procedure, one can act in a morally responsible and just manner, promoting the well-being of both oneself and others.

To know more about morally responsible  click on below link:

https://brainly.com/question/16015419#

#SPJ11

Fundamental Change: What Will You Be Called On to Deal With?

Answers

The occurrence of a change in control or the cessation of trading is referred to as a fundamental change. Change within an organization is one process that took place.

Organization change, for instance, occurs when a particular organization decides to alter positions held by members or employees. In the event that the association executed new guidelines and obligations that Is additionally called as authoritative change.

The idea is that an organization must first "unfreeze" its current procedure in order to look for ways to improve it and ensure that everyone agrees with the need for change. After that, the change is made, and employees are helped through the transition.

To learn more about change

https://brainly.com/question/845364

#SPJ4

imagine you hear a sound in your house while you are sleeping at night. you ask yourself, is someone breaking in, or has your careless roommate dropped a drinking glass? the first interpretation/evaluation of that stimulus evokes fear, while the second evokes anger. this is an example of which theory?

Answers

This is an example of the "Appraisal Theory."The Appraisal Theory suggests that our emotional reactions to events or stimuli are determined by how we evaluate or interpret those events. In this case, the interpretation of the sound as a break-in leads to fear, while the interpretation of the sound as your roommate's carelessness leads to anger.

Learn more about Appraisal Theory: https://brainly.com/question/31359088

#SPJ11      

     

Why is there a neglect of PST due to lack of knowledge ?

Answers

PST, or Problem-Solving Therapy, is a form of psychotherapy that focuses on developing practical, solution-focused strategies for dealing with life problems.

One reason for the neglect of PST may be due to a lack of knowledge about the therapy and its effectiveness. Many mental health professionals may not have been trained in PST, or may not be aware of the research supporting its efficacy.

Additionally, there may be a bias towards more traditional forms of psychotherapy, such as cognitive-behavioral therapy or psychodynamic therapy. These therapies have been more extensively researched and are more widely known, which may contribute to a neglect of PST.

Learn more about Problem-Solving Therapy

https://brainly.com/question/31464294

#SPJ4

when a country is ruled by a small group of people at the top who exercise a great deal of power, often illegitimately obtained, it is termed which of these?

Answers

The term for a country ruled by a small group of people at the top who exercise a great deal of power, often illegitimately obtained, is an "oligarchy."

An oligarchy is a form of government in which power is concentrated in the hands of a few individuals or a small group. These individuals may be from a specific political party, economic class, or social group, and they often use their power to maintain their own interests and benefit themselves.

In an oligarchic system, the ruling elite may manipulate or control the political process, limit civil liberties, or restrict the access of ordinary citizens to resources and opportunities. This concentration of power often leads to corruption, inequality, and a lack of accountability, which can result in social unrest and political instability.

To know more about oligarchy click on below link:

https://brainly.com/question/6827377#

#SPJ11

the action of shutting a port or road to prevent people or supplies from coming into an area or leaving is a called?

Answers

The action of shutting a port or road to prevent people or supplies from coming into an area or leaving is called a blockade. Blockades are typically used as a military or political strategy during times of conflict or crisis to restrict access to vital resources or to weaken an opponent's ability to function.

Blockades can be enforced through various means, such as the use of naval vessels to prevent ships from entering or leaving a port, or the placement of physical barriers on roads or other transportation routes.

The effectiveness of a blockade depends on a variety of factors, including the strength of the enforcing party, the availability of alternative supply routes, and the resilience of the blockaded area.

For more questions like People click the link below:

https://brainly.com/question/18994778

#SPJ11

describe how normative and informational influence processes can help us understand group polarization

Answers

Normative and informational influence processes help us understand group polarization by revealing how social conformity and shared information contribute to the strengthening of group opinions.

Group polarization occurs when group members' opinions become more extreme after discussion.

Normative influence plays a role in this phenomenon by promoting conformity to the group's norms, thus strengthening the group's collective opinion. Members may adopt more extreme views to gain approval from the group, which can intensify the group's overall stance.

Informational influence, on the other hand, involves group members sharing information that supports their opinions. As a result, members are exposed to persuasive arguments that reinforce their initial beliefs. In turn, this leads to a stronger consensus within the group, further contributing to group polarization.

By examining these two influences, we can better understand the factors that drive the intensification of opinions in group settings.

To know more about group polarization click on below link:

https://brainly.com/question/29525993#

#SPJ11

What kind of process is racialization, according to Omi and Wiant? What is it constructed from?

Answers

According to Omi and Winant, racialization is a social process by which a particular social group is defined and marked as different based on physical and cultural characteristics.

This process creates racial categories that are used to classify people and to justify unequal treatment and power relations. Racialization is not a natural or inevitable process, but rather a social construction that is shaped by historical, cultural, and political contexts. It is constructed from various factors such as colonialism, slavery, immigration, nationalism, and the development of racial theories. The process of racialization can lead to the formation of racial hierarchies, discrimination, and social inequality.

To know more about racialization click here:

brainly.com/question/28700943

#SPJ11

Describe a time you didn't have enough time to complete something in your life?

Answers

Instances where one didn't have enough time to complete a task in life, can occur at different times in life. It may be as a student or in a professional environment.

An experience of not having enough time to complete a task occurred in my workplace when I was assigned a project to complete within an unrealistic deadline.

Despite putting in extra hours and effort, and working diligently, I  still struggled to meet the deadline, leading to increased stress and impacts on my job performance.

After spending the night in my workplace trying to gather the information needed to complete the project but was unable to do so because the system went down at midnight.

What did I  do when there was not enough time to complete a task?

When I did not have enough time to complete a task, I had to communicate openly with the parties involved. I inform my boss of the situation and asked for assistance and an extension of the time frame.

From the experience, I learned to better manage my time and resources.

Qualities that play a vital role in navigating situations where there is not enough time to complete a task include:

time management skills, prioritization, and effective communication skills.

Learn more time management at brainly.com/question/24662469

#SPJ1

Was Woodrow Wilson really the turning point for the development of the public presidency?

Answers

No, Woodrow Wilson was not the turning point for the development of the public presidency.

What is presidency?

Presidency is the title and office of the leader of a country or organization. Generally, the president is the head of the executive branch of government and is responsible for leading their nation and/or organization. The president may also be involved in policy making and legislative activities. The president is typically elected by popular vote and serves a term of office.

Although he is often credited with innovating the use of media to communicate with the public and expanding the influence of the executive branch, the roots of a public presidency can be traced back to the early 19th century, with presidents such as Andrew Jackson utilizing the press to shape public opinion and cultivate his own public image. Additionally, presidential power had been growing steadily since the early 1800s with the growth of the federal bureaucracy and the rise of executive orders. Wilson was, however, an important figure in the development of the public presidency, as he was the first president to recognize the importance of media in politics and the potential of using it to gain political capital.

To learn more about presidency

https://brainly.com/question/30193901

#SPJ1

which concept best explains the criticism faced by the single mothers who interviewed for a job while their children played in a mall food court?

Answers

The concept of maternal wall bias best explains the criticism faced by the single mothers who interviewed for a job while their children played in a mall food court.

Maternal wall bias refers to the negative stereotyping and discrimination faced by working mothers, particularly those with young children. This bias is based on the assumption that mothers are less committed to their jobs and less capable of performing well because of their caregiving responsibilities.

In the case of the single mothers who interviewed for a job while their children played in a mall food court, the criticism they faced likely stemmed from this bias. They were likely seen as less competent and less committed to the job because they were juggling caregiving responsibilities while trying to secure employment.

To know more about maternal, click here.

https://brainly.com/question/28274852

#SPJ4

If you received a "10-11" on the radio, what would it mean?

Answers

A "10-11" code on the radio refers to a specific type of message used in a communication system known as "ten-codes" or "10-codes." These codes are commonly utilized by law enforcement and emergency services personnel to convey brief, clear, and standardized messages over radio communication.

When someone receives a "10-11" code, it typically means "transmitting too rapidly" or "speak slower." This code is used to inform the sender that their message was not easily understood due to the speed at which they were speaking. The recipient is essentially requesting that the sender slow down their speech to ensure effective communication and understanding of the information being transmitted.

Using ten-codes like "10-11" allows for quick and efficient exchanges of information among emergency responders, ultimately helping them to better serve their communities. It is important for these professionals to be well-versed in these codes to maintain clear communication, especially during high-pressure situations where every second counts.

For more questions on: communication

https://brainly.com/question/13362487

#SPJ11

If a sample is too small or not random enough, the critical thinker must:

Answers

If a sample is too small or not random enough, the critical thinker must: recognize the potential for sampling bias, question the validity of the results, and consider collecting more data or improving the sampling method.

Sampling bias occurs when a sample does not accurately represent the population it is drawn from. Critical thinkers should be aware of this possibility when evaluating the validity of results based on a small or non-random sample.

To address this issue, they may need to collect more data or use a different sampling method, such as simple random sampling, stratified sampling, or cluster sampling.

By doing so, they can increase the chances of obtaining a more representative and unbiased sample, leading to more accurate and reliable conclusions.

Additionally, critical thinkers should consider other factors that may affect the results, such as the study design, potential confounding variables, and the reliability of the data collection methods.

To know more about critical thinker click on below link:

https://brainly.com/question/31451389#

#SPJ11

Before any drug can make it to market how many phases must they go thru?

Answers

Before a drug can be approved and brought to market, it typically goes through four phases of clinical trials.

Phase 1 trials involve a small group of healthy volunteers to test the drug's safety and dosage. Phase 2 trials involve a larger group of patients to determine the drug's effectiveness and potential side effects. Phase 3 trials involve an even larger group of patients and compare the drug to existing treatments or a placebo. Finally, in phase 4 trials, the drug is monitored after it has been approved and is on the market to ensure its continued safety and effectiveness.

Each phase can take several years to complete, and only a small percentage of drugs make it all the way through to approval.

Learn more about clinical trials.

https://brainly.com/question/30354597

#SPJ4

Animal and plant domestication depends on climatic conditions, including rainfall and temperature. Which climate regions are the driest?

Answers

Dry climate zones are comprised of deserts and steppes.

These are dry and semiarid landscapes with three key characteristics: extremely little precipitation, significant evaporation rates that typically surpass precipitation, and large daily and seasonal temperature variations.

The driest temperature region comprises a hot desert, which is represented by North Africa's Sahara desert. Agriculture is the process of transforming wild plants into crop plants using artificial selection. Typically, a rapid hybridization event is followed by careful breeding.

A domesticated plant is one as has been altered from its natural state to the point where it can no longer grow and reproduce absent human intervention.  Plant domestication is used to adapt plants.

learn more about Deserts and steppes  here:

https://brainly.com/question/31148767

#SPJ4

What is the role of AASHTO (American Association of State Highway and Transportation Officials)?

Answers

AASHTO serves as a vital forum for state DOTs to collaborate, share best practices, and coordinate their efforts to improve the safety, efficiency, and sustainability of the nation's transportation system.

The American Association of State Highway and Transportation Officials (AASHTO) is a non-profit, non-partisan organization that represents the interests of state departments of transportation (DOTs) in the United States. The organization's primary role is to provide guidance and coordination for the development of national transportation policies and standards, with a particular focus on highways and other surface transportation modes.

AASHTO develops and maintains a wide range of technical standards and guidelines, including those related to the design, construction, and maintenance of highways, bridges, and other transportation infrastructure. These standards are widely used by state DOTs and other transportation agencies and are often adopted by federal agencies as well.

In addition to its technical work, AASHTO plays a key role in advocating for transportation policies and funding at the federal level. The organization works closely with Congress and other stakeholders to ensure that state DOTs have the resources they need to maintain and improve the nation's transportation infrastructure.

To learn more about transportation systems

https://brainly.com/question/30116655

#SPJ4

Fred and Eric are identical twins. Which is likely true about their intelligence?

Answers

Fred and Eric, being identical twins, likely share similar levels of intelligence. This is because identical twins share the same genetic makeup, and genetics play a significant role in determining intelligence.

Identical twins are siblings who develop from a single fertilized egg that splits into two separate embryos during early development. Because they come from the same fertilized egg, identical twins share the same DNA and are genetically identical. They are also typically the same sex and have strikingly similar physical appearance, although environmental factors and lifestyle choices can lead to differences in their personalities, interests, and health outcomes. Identical twins are the result of a random and natural occurrence and occur in about 3 out of every 1,000 pregnancies. They can be a valuable subject of study for researchers interested in exploring the relationship between genetics and environment in human development.

Learn more about Identical twins here:

https://brainly.com/question/30490927

#SPJ11

he practice of relying on the judgment of the police leadership and rank-and-file officers to decide which laws to enforce is referred to as question 8 options: limited discretion. selective enforcement. high discretion. full enforcement.

Answers

The practice of relying on the judgment of the police leadership and rank-and-file officers to decide which laws to enforce is referred to as "selective enforcement."

Selective enforcement allows police officers and leadership to use their judgment to determine which laws to enforce and to what extent, based on factors such as the severity of the offense, public safety, and available resources.

This practice acknowledges that it is not feasible for law enforcement to enforce every law in every situation. Selective enforcement provides officers with the flexibility to prioritize certain situations over others, which can be beneficial in maintaining public order and safety.

However, it also has the potential to lead to inconsistencies and biases in law enforcement, making it important to have checks and balances in place to ensure fairness and accountability.

To know more about law enforcement click on below link:

https://brainly.com/question/29422434#

#SPJ11

Why are the questions of turning out good or bad, being led by success, money, power, or even poetry into neglecting justice, or virtue in general important?

Answers

The questions of turning out good or bad, being led by success, money, power, or even poetry into neglecting justice, or virtue in general, are important because they address the moral and ethical implications of one's actions and priorities. These questions highlight the potential consequences of pursuing material or superficial gains at the expense of more profound, intrinsic values like justice and virtue.

Considering the possible outcomes of turning out good or bad serves as a reminder that our choices and actions can lead to either positive or negative consequences. In the quest for success, money, or power, one may inadvertently or deliberately compromise their moral principles, which can result in neglecting justice and the general importance of virtue.

The pursuit of virtues like justice, fairness, and honesty helps create a society where individuals can thrive and coexist harmoniously. In contrast, neglecting these virtues can lead to societal breakdown, corruption, and inequality. It is essential to maintain a balance between achieving personal goals and upholding moral standards.

Furthermore, examining these questions promotes introspection and self-reflection, encouraging individuals to assess their actions and priorities. This self-awareness is crucial in fostering personal growth and development, as well as contributing positively to the community.

In conclusion, these questions are important because they highlight the significance of moral values in personal pursuits, the potential consequences of neglecting these values, and the importance of self-awareness and introspection for individual and societal wellbeing.

Know more about  importance of self-awareness here:

https://brainly.com/question/28507704

#SPJ11

what is wanting to be a physician an example of a primary or secondary drive?

Answers

Wanting to be a physician is an example of a secondary drive.  

Primary drives are biological drives such as hunger, thirst, and sleep, that are innate and necessary for survival. On the other hand, secondary drives are learned or acquired through experience and are not essential for survival.

In the case of wanting to be a physician, it is not a biological drive but rather a learned or acquired drive that is influenced by various factors such as personal interests, values, and career opportunities.

This drive is acquired through experience and exposure to the medical profession, and is not innate or necessary for survival.

Learn more about Drive, here

https://brainly.com/question/30954555

#SPJ4

Individuals who fall within a group identified for special treatment under equal employment laws and regulations, are members of a/ana. oppressed minority.b. protected class.c. employment caste.d. special treatment class.

Answers

Individuals who fall within a group identified for special treatment under equal employment laws and regulations are members of a b. protected class.

According to the Factories Act of 1948, no adult (someone over the age of 18) may work more than 48 hours weekly and 9 hours per day. Furthermore, according to Section 51 of the Act, the period of propagation should not exceed 10-1/2 hours.

Employment contracts containing negative covenants are legitimate and legally enforceable under the Indian Regulation if both individuals settle with their free will, i.e. without coercion, fraud, error, undue influence, or deception.

The Minimum Wage Act, the Administration of Wages Act, the Administration of Bonus Act, the Act on Equal Remuneration, and possibly a few more will be consolidated. The Labour Code on the Industrial Relations will incorporate the Industrial Disputes Act of 1947, the Trade Unions Act of 1926, and the Industrial Relations Act of 1947.

Learn more about employment laws and regulations here:

https://brainly.com/question/1490765

#SPJ4

What does Socrates say about the imitation of the artist?

Answers

According to Socrates, imitation distorted reality, wounding the souls of individuals who accepted imitation as a basis for their arguments despite it not being true.

Every creative production, according to Plato, is an imitation of reality; what actually exists (in the "world of ideas") is an ideal type that God created; the concrete objects that exist in the world are only shadowy projections of this type. Plato said that art is an erroneous understanding of reality.

Common people can be duped by an artist's imitation, but a philosopher cannot be duped since they are aware of reality's essence or the true nature of things. According to Plato's perspective on art from The Republic, it is only a duplicate of an ideal that has been twice removed.

Learn more about Socrates visit: brainly.com/question/334635

#SPJ4

intergeneratibased solely on the idea of life chances, which group would have the greatest chance of survival during time of widespread hardship?

Answers

The group with the greatest chance of survival during a time of widespread hardship would likely be those with access to resources and a higher socio-economic status.

What is resources?

Resources are the physical or virtual materials, services, and people that are used to create and distribute goods and services. Resources can include raw materials, such as land, water, and minerals; human resources, such as labor and knowledge; and technological resources, such as robots, computers, and other inventions.

This group would have access to better medical care, food, housing, and other resources that would help them to survive during difficult times. They would also be more likely to have access to information about the situation, which could help them to make informed decisions about their own safety and well-being. Additionally, they may have access to financial resources that could help them to procure supplies and services during periods of hardship.

To learn more about resources

https://brainly.com/question/1290230

#SPJ1

Other Questions
the scala of the cochlea which houses the actual hearing apparatus Characteristics of human immunodeficiency virus neuropathy include: (Select 2)distal polyneuropathy rapid sudden onset proximal muscle weakness allodynia upper extremities most commonly involved proximal to distal progression of symptoms If cerebral malaria-causing infected erythrocyte in brain venules lost its adhesion to endothelium, it would most likely first flow into which type of blood vessel?a. arteriolesb. veinsc. capillariesd. arteries How can we define entropy using boltzmann's constant? daryl is managing a cross-functional team that often is confined to virtual meetings. he feels like group identity has given way to individual performance measures. what is a practical way that daryl can reorient the team to team goals? THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA? what is the required rate of return on a stock with a beta of 1.9? round your answer to one decimal place. tech a states that a dtc is set if the electrical system of a secondary air injection system fails. tech b states that a check engine light is also illuminated at that instance of component failure. who is correct? solve for particular solution using exponential shift7. (D + 3)'y = 15x2e - 3x 8. (D - 4)'y = 15xe4x 9. DD - 2)2y = 16e2x 10. D'D + 3) y = 9e - 3x 11. (D D 2 y = 18xe" 12. (D? - D - 2)y = 36xe2x Ans.y = 4x'e-3x Ans.y = $x*e** Ans.y = 2x%e2 A hospital ramp for patients is inclined at 25. The height of the ramp is 12 meters. What is the distance a patient will walk on the ramp? Round your answer to the nearest hundredth A DUI conviction will remain on a California driving record for ________ years. If you understand the parts of thinking, you can ask the crucial questions implied by those parts. What was 1970s media coverage of terrorism like? (Terrorist Threat) Strategies such as child life programs, rooming in, therapeutic play, and therapeutic recreation help meet the psychosocial needs of the hospitalized child. Why do you think the Quakers and others on the Underground Railroad provide shelter to the runaways?A. They help for humanitarian and religious reasons.B. They are Northerners who are against Southerners.C. They like Harriet Tubman.D. They wanted to gain political advantage in the North. the phylum cycliophora includes tiny organisms that live in large numbers on the outsides of the mouthparts and appendages of lobsters. the feeding stage permanently attaches to the lobster via an adhesive disk and collects scraps of food from its host's feeding by capturing the scraps in a current created by a ring of cilia. the body is saclike and has a u-shaped intestine that brings the anus close to the mouth. cycliophorans have a coelom, do not molt (though their host does), and their embryos undergo spiral cleavage. based on the information provided, to which clades should cycliophorans belong? Please help me with this ASAP! Ty!Show Your Work! 3) (x-4)2 The pdf of a Gaussian random variable X is given by fx(x) = Ke Find the value of K, and determine the probability of X to be negative in terms of the Q-function. Show your work. = What is the volume of a 2 and 1/4 box "The firehouse trembled as a great flight of jet planes whistled a single note across the black morning sky" (30).