THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?

Answers

Answer 1

The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.

Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.

The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.

To know more about nucleotide sequence visit:

https://brainly.com/question/17105264

#SPJ4


Related Questions

How did King John's actions affect the creation of the Magna Carta
A. his failures led the barons to demand limitations of his power
B. his arguing with the nobles lead the barons to remove him from power
C. his treatment of the nobles lead the barons to demand the separation of the government branches
D. his victory in the war led the barons to sign a peace treaty explaining their rights

Answers

Answer:

A. King John's failures led the barons to demand limitations of his power, which ultimately led to the creation of the Magna Carta.

Explanation:

trust

What is the theme of “The Rose That Grew From Concrete”? Use text evidence to support your answer and be sure to explain.!

Answers

Perseverance and the capacity to overcome challenges are the poem's central themes.

What is the theme ?

The poem "The Rose That Grew From Concrete" by Tupac Shakur tells the story of a rose surviving and thriving in the concrete jungle despite numerous challenges. The poem's main theme is the power of endurance and resiliency in the face of hardship.

Tupac poses the question, "Did you hear about the rose that bloomed from a crack in the concrete," in the opening line of the first stanza. The scene for the poetry is now formed, with the rose serving as a metaphor for human adaptability.

Learn more about the theme: brainly.com/question/25336781

#SPJ1

The Indian Rebellion/Mutiny began with which group of people?a. Sepoysb. Peasantsc. Noblesd. Middle class

Answers

The Indian Rebellion of 1857, also known as the Indian Mutiny, began with the group of Sepoys.

Sepoys were Indian soldiers who served in the British Indian Army. They were primarily recruited from the Hindu and Muslim populations of India and were trained and equipped by the British.

The rebellion began in May 1857, when sepoys stationed in the town of Meerut refused to use new cartridges that were suspected to be greased with animal fat, which was against their religious beliefs.

This sparked a wider revolt among the sepoys, who were joined by various groups, including peasants, nobles, and some members of the middle class.

The rebellion was a significant challenge to British rule in India and was ultimately unsuccessful, leading to the establishment of direct British rule over India.

To know more about Sepoys refer here

https://brainly.com/question/6247924#

#SPJ11

Was there active resistance among the local population torwards colonialism?

Give 1 example

Answers

In the densely populated region of West Africa, several diverse governments and independent communities rejected colonization. An important example of armed resistance was the Mandinka state, which was governed by Samori Ture.

Was the local atmosphere strongly anti-colonial?

Colonialism was resisted in the heavily populated region of West Africa by a number of different governments and autonomous groups. The Mandinka polity under Samori Ture's control serves as an important example of armed resistance. Despite not being a trained religious figure like many other resistance leaders, the rebel commander known as Samori was a Muslim. He did not receive a kingdom as well. Instead, he started from scratch to build the Wassoulou Empire.

What methods did people use to resist colonization?

Colonialism has long-lasting effects and both supported and exercised authoritarian rule over indigenous people. There were several methods to fight back. Other kinds of resistance outside the violent/nonviolent continuum include the call for freedom and equality, religious disagreement, labor & economic organizing, mass protests, and war.

Learn more about colonization: https://brainly.com/question/30900919

#SPJ1

massachusetts responded to shays's rebellion with a group of answer choices reduction of taxes. new issue of additional paper money. moratorium on private debts. dispatch of armed militiamen.

Answers

Massachusetts responded to Shays's Rebellion with the dispatch of armed militiamen. Shays's Rebellion was an armed uprising that occurred in Massachusetts between 1786 and 1787, led by Daniel Shays, a former American Revolutionary War captain.

The rebellion was fueled by a combination of economic difficulties, including high taxes and debt, and political grievances, including the state's refusal to issue paper currency or provide debt relief.

The rebels, who were mostly farmers and rural workers, sought to close the courts and prevent the foreclosure of farms and homes.

In response, the Massachusetts government called up the state militia to put down the rebellion.

The militia, led by General Benjamin Lincoln, engaged the rebels in several skirmishes, ultimately quelling the uprising.

To know more about Massachusetts refer here

https://brainly.com/question/7148546#

#SPJ11

Why was Alexander III deemed to be a tougher Tsar than his father?

Answers

Alexander III was deemed to be a tougher Tsar than his father, Alexander II, due to several factors,

including his policies, response to opposition, and personal beliefs.

Firstly, Alexander III implemented repressive policies aimed at strengthening autocracy and maintaining control over the Russian Empire. These policies, known as the "counter-reforms," included increased censorship, limiting the powers of local governments, and promoting the "Russification" of the empire, which suppressed the rights and culture of non-Russian ethnic groups.

In contrast, Alexander II pursued a more liberal agenda, implementing significant reforms such as the emancipation of serfs in 1861.

Secondly, Alexander III adopted a more forceful approach to opposition. He believed in absolute power and saw any form of dissent as a threat to his authority. In response to the assassination of his father by radical group The People's Will,

he cracked down on political opponents, strengthening the security forces and suppressing revolutionary movements. Alexander II, on the other hand, was more willing to engage with reformist groups and listen to their demands.

Lastly, Alexander III's personal beliefs and upbringing played a role in his tougher approach. He was educated by conservative tutors who instilled in him a deep sense of duty and a strong belief in autocracy.

As a result, he was resistant to change and skeptical of reforms, unlike his father who was more open to liberal ideas.

In conclusion, Alexander III was deemed a tougher Tsar than his father due to his repressive policies, forceful response to opposition, and conservative personal beliefs.

These factors led to an overall more authoritarian and uncompromising approach to governance during his reign.

To know more about Alexander II refer here

https://brainly.com/question/1833055#

#SPJ11

The Law of Superposition states that younger formations ___ older formations.
A. overlook
B. overlie
C. wrap around
D. the Law of Superposition states none of the above

Answers

The Law of Superposition states that the younger formations option B. overlie older formations.

What are formations?

In the context of military operations, formations refer to the organization of troops, vehicles, and equipment into structured groups to carry out specific tasks. These formations can vary depending on the objectives of the mission, the terrain, and the available resources. Some common formations include the line formation, where troops are arranged in a straight line to present a unified front and increase the firepower; the column formation, where troops are arranged in a long line to facilitate movement through narrow spaces; and the wedge formation, where troops are arranged in a V-shape to penetrate enemy lines. Formations can also refer to the organization of teams in sports such as soccer or basketball, where players are arranged in specific positions on the field or court to achieve strategic advantages. Overall, formations are a key aspect of strategic planning and are used to maximize the effectiveness of troops or teams in achieving their objectives.

To learn more about formations, visit:

https://brainly.com/question/3520766

#SPJ1

explain one way in which nationalism movements in italy and germany were similar in the period c. 1750 - c. 1900.

Answers

Answer:

One way in which nationalism movements in Italy and Germany were similar in the period c. 1750 - c. 1900 was their shared desire to unify their respective regions into a single, centralized state.

In both Italy and Germany, the region was divided into a number of smaller states, each with their own ruling class, laws, and customs. This led to a sense of fragmentation and disunity among the people, and many began to believe that a single, unified state was necessary to achieve political and economic stability.

In Italy, the nationalist movement was known as the Risorgimento, or the "Resurgence," and was led by figures such as Giuseppe Garibaldi and Camillo di Cavour. The movement aimed to unify the various states of Italy into a single kingdom, which was achieved with the proclamation of the Kingdom of Italy in 1861.

In Germany, the nationalist movement was known as the Vormärz, or the "pre-March" period, and was characterized by a desire to unify the various German-speaking states into a single nation-state. This was achieved through a series of wars and diplomatic agreements, culminating in the proclamation of the German Empire in 1871.

Both the Italian and German nationalist movements were driven by a sense of national pride and the belief that their respective regions deserved to be independent and unified. They both sought to create a strong, centralized state that could compete on the world stage and provide greater economic and political opportunities for their people.

Explanation:

based on his foreign policy experiences, which president would have most disagreed with america's late 19th century imperialism, as stated in his farewell address? (5.1) a. james k. polk b. thomas jefferson c. james madison d. george washington

Answers

Based on his foreign policy experiences, Thomas Jefferson would have most disagreed with America's late 19th century imperialism, as stated in his farewell address. The correct option is b. thomas jefferson.

Jefferson was a firm believer in isolationism and limited government intervention in foreign affairs. He opposed military intervention and expansionist policies, stating that the United States should focus on developing its own domestic economy and maintaining friendly relations with foreign nations through peaceful diplomacy. Jefferson also opposed the idea of a standing army, believing that it would be used to justify unnecessary wars and imperialistic actions.

His foreign policy views were heavily influenced by his experiences as a diplomat, where he witnessed firsthand the devastating effects of war and imperialism. In conclusion, Jefferson's foreign policy experiences and beliefs align with his opposition to late 19th-century imperialism, making him the president who would have most disagreed with it. The correct option is b. thomas jefferson.

For more about Thomas Jefferson:

https://brainly.com/question/13346823

#SPJ11

Where did Woodward and Bernstein get much of their information about the crimes committed by the presidents men?

Answers

One of the most important sources of  Woodward and Bernstein was a man known only as "Deep Throat," who was later revealed to be Mark Felt, the Deputy Director of the FBI.

Woodward and Bernstein, two reporters for The Washington Post, played a significant role in uncovering the Watergate scandal, which ultimately led to the resignation of President Richard Nixon.

They got much of their information about the crimes committed by the president's men through a combination of anonymous sources and investigative reporting.

Deep Throat provided the reporters with crucial information about the break-in at the Democratic National Committee headquarters at the Watergate complex and the subsequent cover-up by the Nixon administration.

Woodward and Bernstein also conducted extensive interviews with other key figures involved in the scandal, including John Dean, Nixon's White House Counsel, and Jeb Stuart Magruder, Deputy Director of Nixon's Committee to Re-Elect the President (CREEP).

They also obtained documents and other evidence that supported their reporting, including financial records and transcripts of White House conversations.

In addition to their reporting for The Washington Post, Woodward and Bernstein wrote a bestselling book about the Watergate scandal, "All the President's Men," which detailed their investigation and the events that led to Nixon's downfall.

Overall, Woodward and Bernstein's reporting on the Watergate scandal was a remarkable feat of investigative journalism that exposed the criminal activities of the president's men and ultimately helped to restore faith in American democracy.

For more question on "Mark Felt" :

https://brainly.com/question/1120853

#SPJ11

¿Cuánto llego a costar un libro en a edad moderna?

Answers

The cost of books in the modern age can vary greatly.

In general, prices are determined by a number of factors, including the type of book being purchased (new or used), the publisher, and the format (paperback or hardcover). For example, a new paperback novel might cost anywhere from $9.99 to $19.99 depending on who published it; meanwhile,

a used hardback edition of an older title could be as little as three dollars. Additionally, some retailers offer discounts for subscribing to their services or buying multiple copies at once. It’s also possible to find free e-books online through libraries or other sources.

To know more about modern age visit:

https://brainly.com/question/24144566

#SPJ4

Select the correct answer.
What was the most important result of the Land Ordinance of 1785?

Answers

Answer:

the opening up of the Northwestern Territory and the eventual settlement of this region into 5 future states in the United States.

Explanation:

The Oath of the HoratiiJacques-Louis David. 1784 C.E. Oil on canvasDesigned to rally republicans (those who believed in the ideals of a republic, and not a monarchy, for France) by telling them that their cause will require the dedication and sacrifice of the Horatii.

Answers

"The Oath of the Horatii" by Jacques-Louis David is an oil on canvas painting created in 1784, designed to inspire the Republican movement in France by depicting the dedication and sacrifice required to defend the republic.

The painting depicts a scene from ancient Roman history where three brothers swear to defend Rome against the neighboring city of Alba Longa, even if it means sacrificing their lives. The painting's composition and style reflect David's commitment to neoclassicism, a movement that embraced the ideals of the ancient world and promoted republican values.

"The Oath of the Horatii" is considered a masterpiece of neoclassical art and a political statement that rallied the Republican movement in France. It symbolizes the sacrifice and dedication required to defend the republic against tyranny and oppression.

Learn More about neoclassicism:

https://brainly.com/question/1237341

#SPJ4

Complete Question:

Discuss The Oath of the HoratiiJacques-Louis David. 1784 C.E. Oil on canvas. Designed to rally republicans (those who believed in the ideals of a republic, and not a monarchy, for France) by telling them that their cause will require the dedication and sacrifice of the Horatii.

How did the Christian Intelligencer react to the Scribner publication in its 1890 Christmas Eve review of "How the Other..."

Answers

The Christian Intelligencer reacted negatively to the Scribner publication "How the Other Half Lives" in its 1890 Christmas Eve review.

The publication was authored by Jacob Riis and exposed the harsh living conditions of the poor in New York City. The Christian Intelligencer criticized the book for portraying a "dark side" of the city and argued that it was not representative of the overall living conditions in New York.

Additionally, the publication was accused of being biased and sensationalized in its approach to the subject matter. The Christian Intelligencer also expressed concern that the publication would only serve to incite class warfare and further divide the city.

Despite these criticisms, "How the Other Half Lives" became a seminal work in the history of social reform and helped to bring attention to the plight of the poor in New York City.

To know more about Christmas Eve refer here:

https://brainly.com/question/30067566#

#SPJ11

Samir learns about plastic waste in the oceans in school. He wants to do something about this issue. What is the first step for him to take?

request change from local stores
discard the plastic in his house
research plastic pollution
create a policy presentation

Answers

The first step for him to take is to research plastic pollution  to know more about plastic waste Therefore the correct option is  C.

Plastic pollution is a global problem, impacting the health of our environment and its species. Plastic has been around for over 100 years, yet it takes centuries to degrade and never fully disappears. It enters our ecosystems in multiple ways, with the most common being from land-based sources and marine vessels.

This form of pollution poses major threats on wildlife due to long-term impacts such as entanglement and ingestion. In addition, plastic can transport invasive species by attaching itself to organism that unknowingly transfer it from one ecosystem to another.

Hence the correct option is C

To know more about Plastic pollution visit:

https://brainly.com/question/30239984

#SPJ4

When the police questioned a young boy about where he lived how were they finally able to pinpoint his neighborhood?

Answers

When the police questioned the young boy about where he lived, they were finally able to pinpoint his neighborhood by asking him for details about his surroundings and landmarks he could identify in the area.

The police might have also used maps or consulted with locals to narrow down the potential neighborhoods until they found the one that matched the boy's description. Additionally, the police might have checked public records or asked the boy's parents or guardians for information that could help them locate the neighborhood. Once they had a general idea of the area, they likely went door to door or asked people on the street if they recognized the boy or knew where he lived until they were able to find his specific address.

Learn more about police here:

https://brainly.com/question/28211964

#SPJ11

The concept of the ready made was introduced byA. Edward HopperB. Constantin BrancusiC. Louise NevelsonD. Marcel Duchamp

Answers

The concept of the ready-made was introduced by Marcel Duchamp, a French artist who challenged the traditional notion of art in the early 20th century. The correct option is D

Duchamp's ready-mades were everyday objects that he selected and presented as art. The idea was to question the role of the artist in the creation of art and to challenge the value and meaning of art objects. Duchamp's most famous ready-made was a porcelain urinal that he signed with a pseudonym and titled "Fountain".

The piece sparked controversy and challenged the art world's conventional ideas about what constitutes art. The ready-made concept has since influenced and inspired many artists, including Louise Nevelson, who incorporated found objects into her sculptures.

Constantin Brancusi, a Romanian sculptor, also experimented with the ready-made concept in his own way by using natural materials such as stone and wood to create abstract forms.

To know more about Marcel Duchamp refer here:

https://brainly.com/question/10549260#

#SPJ11

Britain had ______ control over all of India trade.a. Halfb. Quarterc. 1⁄5 controld. Full

Answers

Britain had full control over all of India trade. Therefore, correct option is d). Full.  

Is Britain had control over India trade?

Yes, Britain had full control over all of India trade. To clarify, during the colonial period, the British East India Company established its dominance in India and exercised full control over the country's trade, including exports and imports. This control allowed Britain to benefit greatly from India's resources and wealth.

In 1869, the beginning of the Suez Canal increased the British authority over India’s foreign trade. Therefore, correct option is d). Britain had "full" control over all of India's trade.

To know more about India's trade.

visit:

https://brainly.com/question/2637138

#SPJ11

According to Machiavelli how should
Someone wanting power behave

Answers

Answer:

must be willing to act unscrupulously at the right times

Explanation:

Hope this helps!

Question Which statements about the circumstances in Germany that led to Adolf Hitler's rise to power are true?

Answers

There are several statements that could be considered true about the circumstances in Germany that led to Adolf Hitler's rise to power are the Treaty of Versailles, The Weimar Republic, The Great Depression, etc.

What are the statements?

Here are some possible examples:

1. The Treaty of Versailles, which ended World War I, imposed harsh penalties on Germany, including the loss of territory, the payment of reparations, and severe limits on Germany's military and economic power. Many Germans resented these restrictions and felt humiliated by their defeat in the war.

2. The Weimar Republic, the democratic government that was established in Germany after World War I, was weak and unstable. It faced numerous challenges, including economic turmoil, political polarization, and social unrest.

3. The Great Depression, which began in 1929, had a severe impact on Germany's economy and contributed to widespread unemployment, poverty, and social dislocation. This created a sense of crisis and desperation among many Germans.

4. Hitler and the Nazi Party were skilled at exploiting these crises and appealing to the fears, prejudices, and resentments of many Germans. They promised to restore Germany's greatness, eliminate the perceived threats to German identity and security, and create a new order based on racial purity and authoritarianism.

5. Hitler's rise to power was facilitated by a combination of factors, including the weakness of the Weimar Republic, the appeal of his message to many Germans, the support of powerful interest groups and elites, and the lack of effective opposition from other political parties or institutions.

These statements are not exhaustive and there may be other factors that also contributed to Hitler's rise to power. However, they provide a general overview of some of the key historical circumstances and dynamics that led to this pivotal moment in world history.

To know more about territory, visit:

https://brainly.com/question/30475153

#SPJ1

Complete question is: The Treaty of Versailles, The Weimar Republic, The Great Depression, statements about the circumstances in Germany that led to Adolf Hitler's rise to power are true.

What was a lasting contribution of the Freedmen's Bureau after Reconstruction ended?

Question 10 options:

Literacy tests and poll taxes were banned.


Former plantation lands were divided and sold to Black farmers.


More Black men were elected to public office.


Historically Black schools and colleges were established.

Answers

Answer:

More Black men were elected to public office.

Explanation:

More than 1,000 African American schools were built and staffed with qualified instructors.

Which of the following is the biggest threat to the survival of local cultures
and traditions today?

Answers

The biggest threat to the survival of local cultures and traditions today is likely globalization and cultural homogenization.

As people and goods move around the world more easily, cultures are coming into contact and blending together. This can lead to the spread of dominant cultural practices and beliefs, and can make it harder for local cultures and traditions to survive. In addition, as modern technologies and ways of life become more prevalent, younger generations may be less interested in or knowledgeable about traditional practices, further threatening their survival.

Other potential threats to the survival of local cultures and traditions may include economic development, urbanization, environmental degradation, and political instability, among others. However, globalization and cultural homogenization are often seen as the biggest and most pervasive threats in today's interconnected world.

To know more about   local cultures here

https://brainly.com/question/29720923

#SPJ1

What is  is the biggest threat to the survival of local cultures

and traditions today?

prior to its military involvement in both the war of 1812 and world war i, the united states attempted to maintain a policy of

Answers

To secure commercial rights and uphold national honor

Harriet Tubman uses the spiritual "Go Down, Moses" to
A. teach the enslaved Africans about their religion
B. signal her arrival to the enslaved Africans
C. warn the runaway slaves of approaching danger
D. give herself courage to go on

Answers

Harriet Tubman used this song (option A) to teach the enslaved Africans about their religion, particularly about the biblical story of Moses and the Exodus.

Harriet Tubman, a former slave who became a conductor of the Underground Railroad, is known for using various songs to communicate with enslaved Africans and help them escape to freedom.

"Go Down, Moses," a spiritual that dates back to the slavery era, was one of the songs she used.The spiritual "Go Down, Moses" tells the story of Moses leading the Israelites out of slavery in Egypt.  

By sharing this story through song, she was able to impart a message of hope and freedom to those who were suffering in bondage. This also helped to uplift their spirits and give them the strength to persevere.

Moreover, Tubman also used "Go Down, Moses" as a signal to let enslaved Africans know that she was near and ready to help them escape. She would sing the first few lines of the song to let them know that it was safe to come out of hiding and join her on the journey to freedom.

Additionally, the song served as a warning to runaway slaves of approaching danger. When Tubman sang the line "Let my people go," it was a call to action for those who were free to help others escape from bondage.

This was a reminder to the enslaved Africans that they were not alone and that they had allies who were working to help them gain their freedom.

Finally, the spiritual "Go Down, Moses" also gave Tubman the courage to continue her work as a conductor of the Underground Railroad. It reminded her of the struggle for freedom that her ancestors had faced.

It reinforced her own belief that slavery was unjust and needed to be abolished. This strengthened her resolve to keep fighting for the cause of freedom and to lead as many enslaved Africans to freedom as she possibly could.

In conclusion, "Go Down, Moses" was a powerful tool that Harriet Tubman used (option A) to teach the enslaved Africans about their religion

The spiritual conveyed a message of hope, courage, and determination, and it remains a testament to the resilience of the human spirit in the face of oppression.

For more question on "Harriet Tubman" :

https://brainly.com/question/22373983

#SPJ11

What were three new weapons that made the Hundred Years' War especially deadly?

Answers

Answer:

The Hundred Years' War was fought between England and France from 1337 to 1453, and it saw the development and use of several new weapons that contributed to the war's deadliness. Here are three such weapons:

Longbow: The English longbow was a powerful and deadly weapon that could shoot arrows at a greater distance and with greater accuracy than other archery weapons of the time. English archers using longbows played a significant role in the early battles of the Hundred Years' War, most notably at the Battle of Crécy in 1346.

Cannon: The use of gunpowder weapons, specifically cannons, became more widespread during the later stages of the Hundred Years' War. Cannons could damage fortifications and cause significant casualties, and they contributed to the decline of the castle as a stronghold.

Crossbow: The crossbow was a powerful weapon that could pierce armor, and it was widely used by both the English and the French during the war. Crossbowmen could deliver a large number of bolts in a short period, making them an effective weapon in certain circumstances.

Explanation:

The Stone BreakersGustave Courbet. 1849 C.E. (destroyed in 1945). Oil canvasHe attempts to be even-handed, attending to faces and rock equally. In these ways, The Stonebreakers seems to lack the basics of art (things like a composition that selects and organizes, aerial perspective and finish) and as a result, it feels more "real."

Answers

"The Stone Breakers" by Gustave Courbet is a painting that lacks traditional artistic elements like composition and aerial perspective, but it conveys a sense of realism and social commentary that makes it a significant work of art.

"The Stone Breakers" depicts two laborers breaking stones for a road. The painting's composition is simple, with the figures placed in the foreground and a rocky landscape in the background. The painting lacks aerial perspective and finishes, giving it a raw and unpolished look.

However, the painting's lack of traditional artistic elements contributes to its power as a social commentary on the plight of the working class. The painting's focus on the laborers' faces and the harshness of their work conveys a sense of realism that reflects the struggles of the working poor in mid-19th century France.

Courbet's attempt to be even-handed in his treatment of the laborers and the rocks also contributes to the painting's power. The painting presents a realistic depiction of the laborers' work, without romanticizing or idealizing their circumstances.

Learn More about Stonebreakers

https://brainly.com/question/1022342

#SPJ4

Complete Question :

Discuss The Stone Breakers Gustave Courbet. 1849 C.E. (destroyed in 1945). Oil canvas. He attempts to be even-handed, attending to faces and rock equally. In these ways, The Stonebreakers seems to lack the basics of art (things like a composition that selects and organizes, aerial perspective, and finish) and as a result, it feels more "real."

Please help hurry I’ll mark brainly

1. Research "Imperialism" and "Primary Sources." (If you do an internet search with those key terms, many websites will appear that supply primary sources for Imperialism.)

2. Choose three primary sources whose topic is "Imperialism" that were created between
1750 and 1910. At least one of these sources must be a political cartoon from the time
period.

3. Create a presentation using these sources. For each source, include: a copy or excerpt of the source an explanation of how the source illustrates ethnocentrism citation of where you found the source.

Answers

Imperialism is historical phenomenon characterized by the expansion of a nation's power and influence through acquisition of territories and the subjugation of other peoples.

What is Imperialism?

Imperialism is a political and economic system in which a powerful nation-state seeks to exert control over other countries or territories through the use of military, economic, and cultural power. Imperial powers often justify their actions as a way of bringing civilization, modernization, or democracy to less developed regions, but in reality, their primary goal is to extract resources and exploit labor to benefit their own economy and society. Imperialism can have a devastating impact on the colonized nations, leading to the displacement and exploitation of indigenous peoples, the destruction of local economies and cultures, and the suppression of political and social freedoms. It has been a significant force in shaping the modern world, both in terms of its legacies and ongoing impact.

To learn more about imperialism, visit:

https://brainly.com/question/9194678

#SPJ1

14. What were the functions of the monks and nuns in the Byzantine Empire?

Answers

In the Byzantine Empire, monks and nuns played a crucial role in the religious and social life of the community.

They were responsible for preserving and promoting the Christian faith, and often served as teachers and spiritual advisors. Monks also engaged in scholarly pursuits, such as copying and preserving ancient texts, and developing new theological and philosophical ideas.

Nuns were often involved in charitable work, such as caring for the sick and poor, and running orphanages and hospices. Additionally, both monks and nuns were often called upon to provide counsel to the ruling class, and their opinions were highly valued in matters of state.

Overall, monks and nuns were seen as important contributors to the spiritual and cultural life of the Byzantine Empire.

To know more about Byzantine Empire,refer to the link:

https://brainly.com/question/18205624#

#SPJ11

Circular finance was a big problem in the 1920s. Where did Germany borrow money to pay reparations?

Answers

After World War I, Germany was required to pay heavy reparations to the Allied Powers under the Treaty of Versailles. To support these repayments, Germany borrowed money from American banks and investors through loans and bonds. This practice led to a circular finance system, as Germany used the reparations payments from the Allied Powers to pay back the loans it had received, which in turn allowed it to continue making the reparations payments. However, when the Great Depression hit in the late 1920s, the circular finance system collapsed, leading to defaults and economic instability.

question which of the following best describes the columbian exchange? responses the rate at which european currencies were traded for local american goods the rate at which european currencies were traded for local american goods the conversion of native peoples to christianity by spanish friars the conversion of native peoples to christianity by spanish friars the discovery of the americas by christopher columbus the discovery of the americas by christopher columbus the transfer of peoples, diseases, plants, and animals between the new and old worlds

Answers

The best description of the Columbian Exchange is the transfer of peoples, diseases, plants, and animals between the New and Old Worlds.

The Columbian Exchange, which began after Christopher Columbus' discovery of the Americas, was a significant period of cultural and biological exchanges between the Old World (Europe, Asia, and Africa) and the New World (the Americas).

This exchange involved the transfer of various plants, animals, diseases, and human populations across the Atlantic Ocean, leading to profound changes in both regions.

European explorers brought crops, animals, and technologies to the Americas, while they took back new crops, animals, and other resources to the Old World.

However, one of the most significant and devastating aspects of the Columbian Exchange was the transmission of diseases, such as smallpox, from Europeans to Native American populations, which resulted in significant population decline among the native peoples.

In summary, the Columbian Exchange best refers to the transfer of peoples, diseases, plants, and animals between the New and Old Worlds, rather than the other options provided in the question.

To know more about refer Columbian Exchange here

brainly.com/question/2206977#

#SPJ11

Other Questions
Karen is filling out an application for medical school. The application requires that Karen supply her MCAT score. Karen scored 512 on the MCAT. The mean MCAT score is 500.9 with a standard deviation of 10.6. What is her z-score for the MCAT? Round your solution to the nearest hundredth (second decimal value). 78) Which solution component will have the lowest concentration at the end of the kinetic assay described in the passage?LactateADPATPNAD+ What is the difference between a sensor and a collector, in the context of SIEM? The nurse is reviewing a client's plan of care. The following statement appears on the client's plan of care: "Client will ambulate in the hall without assistance within 4 days." What does the nurse recognize this statement as an example of? Besides providing first aid, what else should a security guard do at an emergency scene? Complete the statement to produce the following array:1,1,1,0,01,1,1,0,01,1,1,0,0 Complete the following statement: An individual copper atom emits electromagnetic radiation with wavelengths that are An orange-colored sign (shoulder work ahead) like this means: 13. How was religion politics meshed together in the Byzantine Empire? how can we define melting temperature in terms of protein folding? Recognition of concordances between episodes in Old and New Testaments is called? A random sample of size ni = 25, taken from a normal population with a standard deviation 04 = 6, has a mean X4 = 81. A second random sample of size n2 = 36, taken from a different normal population with a standard deviation o2 = 4, has a mean x2 = 35. Find a 98% confidence interval for My - H2. Click here to view page 1 of the standard normal distribution table. Click here to view page 2 of the standard normal distribution table. The confidence interval is According to Erikson, an adolescent who's suffering from gender dysphoria can't progress through which developmental task? Why is Hugo so determined to destroy Edward? Count one, two, three after the vehicle ahead has started to move before placing my vehicle in motion.This step is to be followed when stopped at an intersection behind another vehicle. Check rear view mirrors. Individual differences in perceiving pain are an example of ... influences on pain. Such influence demonstrate that pain is not merely a ... phenomenon, as proposed centuries ago by. .. Rather, pain is created by the ... Why is rDNA important?Recombinant blood-clotting factor VIII: organizations and functions that mine, make, assemble, or deliver materials and products from manufacturer to consumer are referred to as . the equivalence point of a weak acid titration is identified by a dramatic in ph, resulting in a sharp increase in the titration curve. responses increase; vertical increase; vertical decrease; vertical decrease; vertical increase; horizontal increase; horizontal decrease; horizontal Why do large game studios frequently update finished games?O A. To keep their players' interest over timeB. To get a better grasp of their players' demographicsC. To ensure that licensing problems do not developD. To determine what games players will want in the futureits a