The contract between BootMagic and its union is due to expire in 30 days. If the union and BootMagic cannot successfully negotiate a contract, who must be notified?a.the NLRBb.the FMCSc.the AFL-CIOd.the U.S. Secretary of Labor

Answers

Answer 1

If the contract between BootMagic and its union is due to expire in 30 days and they cannot successfully negotiate a new contract, the National Labor Relations Board (NLRB) must be notified, as it is the federal agency responsible for enforcing the NLRA.

The correct option is A.

The NLRB is a federal agency responsible for enforcing the National Labor Relations Act (NLRA), which protects the rights of employees to organize and collectively bargain with their employers. The NLRB has the authority to investigate and remedy unfair labour practices and to oversee union representation elections and collective bargaining.

Under the NLRA, if the union and the employer cannot agree on a new contract and the negotiations reach an impasse, either party may request the Federal Mediation and Conciliation Service (FMCS) to help them resolve the dispute. However, neither the AFL-CIO nor the U.S. Secretary of Labor must be notified.

To learn more about National Labor Relations Board, visit:

https://brainly.com/question/29762993

#SPJ4


Related Questions

T devises property "to my grandchildren who reach 21." T leaves two children and three grandchildren under 21.

Answers

T devises property "to my grandchildren who reach 21." T leaves two children and three grandchildren under 21. This is valid.

If a person passes away without making a will, or "intestate," then his or her assets will be distributed in accordance with state statutes that are written and explained therein.

The T leaves a will to my grandchildren when they become 21. It is allocated to people above the age of 21 if there are two children and three grandchildren who are under the age of 21. This criterion fulfills the attributes of will-making based on the law.

Learn more about the property, here:

https://brainly.com/question/14285518

#SPJ4

The complete question is probably

T devises property "to my grandchildren who reach 21." T leaves two children and three grandchildren under 21. Is this valid?

The decline in union membership can be attributed to:a. many workers have become disenfranchised with their unions.b. corrupt union leadership.c. union members' perception that cost of membership outweighs the benefits.d. All of these are correct.

Answers

Option (d), The disenchantment of many employees with their unions, corrupt union leadership, and the belief among union members that the costs of participation exceed the benefits all contribute to the drop in union membership.

What are the reasons behind the demise of the unions?

At its peak in the 1950s, around one-third of private sector employment was unionized; now, that number is barely over 6%. Technical development, company concentration, and globalization are frequently cited as the main causes of weakening union authority and an improvement in employers' bargaining position relative to workers.

How does a union go about representing the interests of each of its members?

Collective bargaining is a process wherein employees and employers negotiate contracts to specify terms of employment such as compensation, benefits, working conditions, hours, leave, workplace health and safety standards, ways to balance work and family duties, and more.

What three elements might be the cause of the decline in union membership?

Technical development, company concentration, and globalization are frequently cited as the main causes of weakening union authority and an improvement in employers' bargaining position relative to workers.

Learn more about union membership: https://brainly.com/question/2484380

#SPJ1

The complete question is:

The decline in union membership can be attributed to:

a. many workers have become disenfranchised with their unions.

b. corrupt union leadership.

c. union members' perception that cost of membership outweighs the benefits.

d. All of these are correct.

​TRUE/FALSE. If there is a reference to a third party to determine a dispute, in most cases the decision is binding.

Answers

The statement "If there is a reference to a third party to determine a dispute, in most cases the decision is binding" is true because when parties agree to refer a dispute to a third party for resolution, they are essentially entering into a contract with that third party to be bound by their decision.

This is often done through a process called arbitration, where the parties agree to have a neutral third party make a binding decision based on the evidence presented to them.

In some cases, the decision of the third party can be challenged or appealed, but this is usually only allowed in limited circumstances, such as where there was a procedural error or bias on the part of the third party.

Overall, the use of third-party dispute resolution mechanisms can be a useful way for parties to resolve disputes without the need for lengthy and expensive litigation.

However, it is important for parties to carefully consider the terms of any such agreement and ensure that they are comfortable with the potential outcome before agreeing to refer their dispute to a third party.

To know more about disputes refer here:

https://brainly.com/question/29497887#

#SPJ11

3. When did Black Women recieve the right to vote in federal elections?

Answers

Black women received the right to vote in federal elections in 1965 with the passage of the Voting Rights Act. This critical law outlawed racial bias in electoral procedures.

The correct answer is 1965.

Before the Voting Rights Act, many states had implemented discriminatory practices such as poll taxes, literacy tests, and other requirements that disproportionately affected Black voters. These practices were used to deny Black women and men the right to vote and other forms of disenfranchisement, such as violent intimidation and threats.

The Voting Rights Act was a critical triumph for the civil rights movement. It paved the way for more excellent political representation and participation by Black women and other marginalized groups.

To know more about right to vote, visit:

https://brainly.com/question/29759734

#SPJ4

A criminal case differs from a tort case because:a. in a criminal case the victim does not receive compensationb. in a criminal case the victim is a witnessc. a criminal case is brought against the alleged wrongdoer by the governmentd. all of the specific answer choicese. none of the other specific choices

Answers

A criminal case differs from a tort case because: c. a criminal case is brought against the alleged wrongdoer by the government.

A criminal case is different from a tort case in that it is filed by a prosecutor on behalf of state or society and contains accusations of misconduct that are seen as crimes against society as a whole. In a criminal case, suspected offender is accused of a crime and, if proven guilty, might be punished with fines, jail time, or other types of punishment. The victim of the crime may testify in the criminal case, but neither they nor the prosecution are the ones who start it.

A tort case, on the other hand, deals with civil wrongs that hurt a person or piece of property, and it is often brought by the victim against the accused perpetrator. In a tort lawsuit, the plaintiff seeks restitution for losses brought on by the defendant's claimed wrongdoing; the victim is compensated rather than the offender is punished. However, In specific event that the tort action is successful, the victim can be compensated.

Read more about criminal case on:

https://brainly.com/question/4354802

#SPJ4

Suppose that a landlord, L, has a tenant, T, that leases to T1 and included a right of re-entry. What rights does L have over T1 under the privity of estate?

Answers

Under the privity of estate, if T1 breaches the terms of the lease agreement with T, L may have the right of re-entry, which would allow L to terminate the lease agreement and regain possession of the property.

A lease agreement is a legal contract between a landlord (lessor) and a tenant (lessee) that sets out the terms and conditions of renting a property. It outlines the responsibilities of both the landlord and the tenant during the lease term.

The right of re-entry is a contractual provision that allows the landlord to terminate the lease and regain possession of the property if the tenant or sub-tenant violates a specific term or condition of the lease agreement.

Learn more about lease agreement here:

https://brainly.com/question/30193309

#SPJ4

fill in the blank. The Sarbanes-Oxley Act increased the maximum jail sentence for fraudulent reporting to__years.
20

Answers

The Sarbanes-Oxley Act, passed in 2002 in response to corporate accounting scandals, increased the maximum jail sentence for fraudulent reporting to 20 years.

The law was named after its sponsors, Senator Paul Sarbanes and Representative Michael Oxley, and aimed to restore public trust in the financial reporting of publicly traded companies. Among its provisions, the act established stricter accounting and auditing standards, required companies to disclose any material financial information, and created the Public Company Accounting Oversight Board to oversee accounting firms. Failure to comply with these regulations can result in severe penalties, including hefty fines and lengthy prison sentences.

For more such questions on Sarbanes-Oxley Act, click on:

https://brainly.com/question/29336194

#SPJ11

Larry breaks into the local pharmacy where he steals a variety of controlled substances. In an effort to cover up his burglary, Larry sets fire to building. Larry has committed:

Answers

Larry has committed two separate crimes: burglary and arson.

Burglary is a crime that involves the unlawful entry into a building or other structure with the intent to commit a felony or theft. In this case, Larry entered the local pharmacy unlawfully with the intent to steal controlled substances, which is a felony. Therefore, he has committed the crime of burglary.

Arson is a separate crime that involves the willful and malicious burning of someone else's property. In this case, Larry set fire to the building in an attempt to cover up his burglary. By doing so, he not only caused damage to the pharmacy building, but he also put people's lives in danger. Therefore, he has committed the crime of arson.

Larry may face separate charges for each of these crimes, and the penalties for burglary and arson can be significant, including fines, imprisonment, and other consequences.

To know more about burglary here:

https://brainly.com/question/30777991

#SPJ4

Employers must comply with a variety of federal and state laws as part of their efforts when developing and maintaining healthy, safe, and secure workforces and working environments.TrueFalse

Answers

This is true, The accountability for maintenance of employee fitness and security is with all, Employees, Employers, Government.

Which act establishes duties and rights for employers and employees?

Explanation: OSHA establishes coaching programs, develops mandatory job protection and fitness standards, and encourages to put in force them.

Safety is the business and responsibility of each worker and can be executed via appropriate education, training, use of protective equipment and by following security rules, regulations, standards, and laws. Each worker is accountable for grasp and practising splendid protection procedures.

Learn more about Employers rights  here:

https://brainly.com/question/29571857#SPJ1

Due to criticism that the proximate cause rule is difficult to understand and apply, some states have replaced it with the:a. fault factor testb. considerable factor test c. substantial factor testd. ultimate cause rulee. none of the other choices

Answers

Due to criticism that the proximate cause rule is difficult to understand and apply, some states have replaced it with the: c. substantial factor test

A legal theory known as the proximate cause rule in tort law restricts a defendant's culpability to damages that were reasonably foreseeable as a result of their actions or inactions. However, some states have substituted other standards, including the "substantial factor test," in place of the proximate cause rule due to criticism that it can be challenging to grasp and apply in some situations.

In situations when several circumstances contribute to the injury sustained by a plaintiff, the substantial factor test is a criteria used to establish causation. According to this standard, a defendant may be found accountable if their actions had a significant role in the injury, even if other people or things also played a role. This technique is frequently applied in situations involving complicated or many causes, such as those involving hazardous torts, product responsibility, or environmental contamination.

Read more about tort law on:

https://brainly.com/question/31580458

#SPJ4

A statement in the employee handbook that the employee or the employer may terminate the relationship at any time, for any reason, with or without cause or notice is called a/an ____ statement.implied contracttemporary employmentemployment-at-willno-fault-employment

Answers

A statement in the employee handbook that the employee or the employer may terminate the relationship at any time, for any reason, with or without cause or notice is called an employment-at-will statement. The correct option is c.

Employment-at-will is a common law doctrine that applies in many states in the United States, including Texas. It means that absent a contract or statutory provision to the contrary, an employer can terminate an employee at any time, for any reason, with or without cause or notice, and an employee can leave their job at any time, for any reason, with or without notice.

The employment-at-will doctrine is often expressed in employee handbooks or other employment policies, and the language described here is a typical example of an employment-at-will statement. Therefore, the correct option is c.

To know more about employee handbook here:

https://brainly.com/question/5754826

#SPJ4

Cable thieves have been busy with attempts to steal electrical cables overnight on the outskirts of Tshwane. As a result of their illegal activities, a live electrical cable is hanging low over a public road. While driving towards his workplace, Mr Ngwenya, who lives on a smallholding outside Tshwane, sees the low-hanging cable. As a concerned and responsible citizen, Mr Ngwenya immediately reports it to ESKOM, explaining to the ESKOM officials that the low-hanging cable is creating an extremely hazardous situation. However, ESKOM does nothing to eliminate the danger. Late that afternoon, Mr Naidoo, a physically fit man, but with poor eyesight, jogs along the road. His head hits the low-hanging electrical cable, and he sustains severe injuries. Mr Naidoo wishes to institute a delictual action against ESKOM.

Write an opinion, properly substantiated with reference to case law, only on the wrongfulness of the conduct of the ESKOM official

Answers

A delict happens when one party commits a incorrect towards another. The fundamental factors of delict are conduct, wrongfulness, fault, causation and damage. Wrongfulness or unlawfulness: conduct which is objectively unreasonable and barring  lawful justification.

How do you decide wrongfulness?

The criterion of wrongfulness in the end depends on a judicial determination of whether, assuming all the other elements of delictual legal responsibility are present, it would be practical to impose liability on a defendant for the damages flowing from precise conduct.

Van der Walt and Midgley (Delict 145 fn 4) refer to these three cases as nicely as Lampert v Hefer (supra), as situations where the defence of volenti non suit iniuria has been successfully raised (since 1928).

Learn more about wrongfulness here:

https://brainly.com/question/6203610#SPJ1

a state attorney general may recover up to how much in damages (civil penalties) resulting from sherman act violations?

Answers

don’t know to be honest

element 2 of rule of law: equality before the law

Answers

Equality before the law is the second element of the rule of law, which is a fundamental principle of democratic societies. It means that every person, regardless of their status, wealth, race, gender, or any other personal characteristic, is equal in the eyes of the law.

In other words, the law applies equally to all individuals and no one is above the law. This principle ensures that everyone is entitled to the same legal protections and freedoms and that no one is discriminated against or mistreated by the legal system.

Equality before the law is essential for maintaining the integrity and legitimacy of the legal system. It helps to build public trust in the legal system and ensures that justice is administered fairly and impartially. When the law is applied equally, people can have confidence that their rights will be protected and that justice will be served.

To learn more about Equality before the law, visit:

https://brainly.com/question/14790588

#SPJ4

what is When an Amendment Relates Back.

Answers

When an amendment relates back, it means that a revised legal pleading is treated as if it were filed at the same time as the original pleading. This is significant because it affects the statute of limitations and other time-sensitive aspects of a case.

For example, if a plaintiff files a complaint that includes a claim that is later found to be deficient, the plaintiff may seek to leave to amend the complaint to correct the deficiency.

If the court grants the motion to amend and allows the amended complaint to relate back to the original filing date, the plaintiff will avoid being time-barred by the statute of limitations.

The doctrine of relation back is governed by rules of civil procedure and varies by jurisdiction. Generally, an amendment may relate back if it arises from the same transaction or occurrence as the original claim and if the defendant had notice of the claim within the applicable statute of limitations period.

To learn more about amendment

https://brainly.com/question/13276616

#SPJ4

Intentional physical contact without consent may constitute:a. battery b. assaultc. defamation d. duresse. false imprisonment

Answers

Intentional physical contact without consent may constitute a) battery. Battery occurs when there is unlawful and intentional physical contact with another person without their consent.

It can be a punch, a slap, or any form of physical contact that results in injury or harm to the other person. Assault, on the other hand, is the intentional threat or attempt to cause physical harm to another person. It is the fear of harm rather than the actual harm itself.

Defamation, duress, and false imprisonment do not involve physical contact, but rather involve harm caused by words, coercion, or confinement, respectively.

To know more about physical contact visit:

https://brainly.com/question/29567827

#SPJ11

what is Amendments Before Trial, Time to Respond

Answers

Amendments before trial refer to changes that a party to a lawsuit wants to make to their pleading before the trial commences. These amendments may include adding, deleting, or modifying claims or defenses, or correcting errors or omissions in the original pleading.

The time to respond to an amendment before trial depends on the specific rules of the court where the case is being heard. Generally, the opposing party must be given notice of the proposed amendment and an opportunity to respond, either by filing a responsive pleading or by objecting to the amendment. The court may also set a deadline for the parties to file any amendments or objections, and may hold a hearing to consider the proposed amendments and any objections raised by the opposing party.

Learn more about Amendments

https://brainly.com/question/13276616

#SPJ4

What is report of traffic accident occurring in California SR 1?

Answers

Report of traffic accidents occurring in California SR 1 is California State University Maritime Academy's "SR-1 Form" for reporting traffic accidents on California State highways used to document any property damage, injuries, or fatalities resulting from the accident.

The California DMV requires that the SR-1 Form be submitted within 10 days of the accident. This requirement applies to all accidents on a California State highway, regardless of who is at fault. If the accident involves injury, death, or property damage over $1,000, it must be reported using the SR-1 Form.

The SR-1 Form is typically completed by the driver involved in the accident or by their insurance company. It requires detailed information about the accident, such as the date, time, and location, as well as all parties' names and contact information.

To know more about California, visit:

https://brainly.com/question/30050163

#SPJ4

Example 32. O devises land "to such of A's children who survive to age 25." Suppose that at O 's death A is alive and has three children, all of whom are younger than 25 and at least one of whom is younger than 4. .

Answers

No life estate precedes the interest given to A's children. The executory interest in A's children is void. The invalidating chain of events is that A may have another child after O 's death, and that child may reach age 25 more than 21 years after the death of A and A's three children who were alive at O 's death.

For a class gift to be vested under the Rule, the class must be closed and all conditions precedent for each and every member of the class must be satisfied, within the perpetuities period. Thus suppose a gift "to A for life, then to A's child, and A has living one child, B. B's remainder is vested subject to open, but it is not vested under the Rule Against Perpetuities until A dies and all of A's children are then in existence and identified. But because the remainder beneficiaries will all be ascertained at A's death, the remainder is valid.

Class closing rule: The possibility that more members may be added to a class at a remote point in the future creates a potential violation of the Rule Against Perpetuities for some class gifts.

Learn more about child, here:

https://brainly.com/question/28378740

#SPJ4

A major purpose of tort law is to:a. replace the insurance industryb. provide compensation for injured parties by wrongdoers c. impose criminal penalties on the negligentd. ensure Equal Protection of the 14th Amendment is operational e. ensure the effective operation of the Due Process Clause

Answers

The major purpose of tort law is to provide compensation for injured parties by wrongdoers. option (b)

Tort law deals with civil wrongs committed by individuals or entities that result in harm or injury to another person or property. The law aims to provide a means of redress for those who have suffered losses due to the actions of others. Tort law is not concerned with criminal penalties, as it is a separate branch of law.

Additionally, while the principles of equal protection and due process are fundamental to the American legal system, they are not the primary focus of tort law.

Learn more about criminal penalties

https://brainly.com/question/31318693

#SPJ4

If OC expert is requiring pre-payment of depo fee, does DFC prepay and then sends citizens the invoice?

Answers

No, DFC does not prepay the OC Expert's deposition fee. DFC will invoice the citizen for the OC Expert's fee, and the citizen is responsible for making the payment directly to the OC Expert.

What is fee ?

Fee is a payment made to a person or organization for services rendered. It is typically charged as a flat rate or hourly rate, and can be paid either in advance or after the service has been provided. Fees can be paid for a variety of services, such as legal advice, medical treatments, or educational courses. They can also be paid to an individual or organization for the use of goods, property, or other resources. Fees are an important source of income for many businesses and organizations, and in most cases, payment of the fee is required before the service can be rendered.

To learn more about fee

https://brainly.com/question/29578294

#SPJ1

O conveys "to A for life, then to B and her heirs, but if A is survived at his death by any children, then to such surviving children and their heirs." At the time of the conveyance, A is alive and has two children, C and D. What is the state of the title?

Answers

The state of the title is given as

A: Life estate

B: vested remainder in fee simple absolute subject to complete divestment and subject to open

C and D: Executory interest, shifting

Any payment, including those in fee simple or property in forever, or any State lease, whenever authorized or given by or on the authority of the Crown, is considered to have a state title.

The legal ownership of a piece of property or other asset is shown by a title. A title may represent the right to ownership of tangible or intangible assets, such as a trademark, or real property.

Learn more about the estate, here:

https://brainly.com/question/30565515

#SPJ4

Self-defense is a based on the need to allow people who are attacked to take steps to protect themselves. a. proximate causeb. defense c. consent d. privilegee. none of the other choices

Answers

Self-defense is considered a legal defense, which means that it allows a person to use force to defend themselves against an imminent threat.

The defense is based on the idea that individuals have the right to protect themselves from harm and that their actions are justified if they are acting in self-defense. In order for self-defense to be a valid defense, the individual must be facing an immediate threat of harm and must use only the amount of force necessary to protect themselves.

This defense is different from "privilege", which refers to a legal exemption from liability, and "consent", which means that a person has given their agreement for an action to take place. "Proximate cause" refers to the event that directly leads to an injury or harm, but is not related to self-defense.

To know more about Self-defense visit:

https://brainly.com/question/1525962

#SPJ11

Who enforces sound violations at mass gatherings?

Answers

In most cases, sound violations at mass gatherings are enforced by local law enforcement or code enforcement officers.

These officials are responsible for ensuring that the event organizers comply with local noise ordinances and regulations. They may use sound level meters to measure the decibel levels of the event and issue warnings or citations if necessary.

However, it is important to note that enforcement methods can vary depending on the location and the specific regulations in place. In some cases, event organizers may be required to obtain permits or hire professional sound engineers to ensure that the event stays within acceptable noise levels. Ultimately, the goal is to balance the needs of the event organizers with the rights of nearby residents to enjoy a peaceful and quiet environment.

For more such questions on law enforcement, click on:

https://brainly.com/question/29422434

#SPJ11

The ____ Act made certain anti-union actions by management unfair labor practices.Railway LaborWagnerCivil Service Reform

Answers

The Wagner Act made certain anti-union actions by management unfair labour practices to protect workers' rights to form and join unions, engage in collective bargaining, and participate in other union activities.

The correct option is C.

The National Labor Relations Act (NLRA), also known as the Wagner Act, is a federal law that was enacted in 1935. The act created the National Labor Relations Board (NLRB), responsible for enforcing the law and resolving disputes between employers and unions.

The Wagner Act also provides for the right of employees to engage in strikes, picketing, and other forms of collective action, as long as these activities are peaceful and do not involve violence or coercion. Additionally, the act prohibits employers from establishing company unions, which are unions controlled by management and not independent organizations representing the interests of workers.

To learn more about Wagner Act, visit:

https://brainly.com/question/30723171

#SPJ4

Assumption of risk is a(n) _____ defense. a. proactiveb. positivec. conciliatory d. affirmativee. none of the other choices

Answers

Assumption of risk is a(n) affirmative defense. option (D)

Assumption of risk is an affirmative defense in tort law that can be raised by a defendant to escape liability for injuries suffered by the plaintiff. The defense is based on the idea that the plaintiff knew of the risks involved in an activity and voluntarily assumed those risks, and therefore cannot hold the defendant responsible for any resulting injuries.

To successfully invoke the defense of assumption of risk, the defendant must show that the plaintiff had knowledge of the risks involved in the activity, voluntarily participated in the activity despite the risks and that the plaintiff's injuries were caused by those risks. This defense is often raised in cases involving sports or recreational activities, where participants assume certain inherent risks.

Therefore, option (d) affirmative is the correct choice to describe the assumption of risk as a defense in tort law.

Learn more about affirmative defense

https://brainly.com/question/30021859

#SPJ4

Why does the Party try to isolate citizens from each other?
A. To prevent romantic relationships from occurring
B. To prevent citizens from discussing the Party's policies and rising up against the government
C. To prevent an outbreak of a deadly pandemic
D. To maintain class separation

Answers

Answer:

B to prevent citizen from discussing the party policies and rising up against the government

The Party in George Orwell's novel 1984 tries to isolate citizens from each other mainly to prevent them from discussing the Party's policies and rising up against the government. The correct option is B

This is because the Party's ultimate goal is to maintain absolute control over the population and any form of dissent or rebellion is seen as a threat to its power.

Additionally, the Party discourages romantic relationships as they may distract citizens from their loyalty to the Party and potentially create a sense of loyalty towards their partner instead.

Maintaining class separation is also a tactic used by the Party to prevent unity among citizens and maintain the hierarchical structure of society.

The prevention of a deadly pandemic is not a primary reason for the Party's isolation tactics in the novel.

To know more about George Orwell's refer here:

https://brainly.com/question/12380617#

#SPJ11

If OC expert is requiring pre-payment of depo fee, DFC prepays and then sends us the invoice, correct?

Answers

Answer:

calculate it by self and know

Answer: There are certain situations where a deposit is required from either buyer or seller. In such cases, you may issue a prepayment invoice, sometimes called a prepaid invoice.

A prepayment invoice is a document used to record advance payments from suppliers or clients. It contains the amount to be prepaid on a sales order and enables you to invoice deposits required from clients or sellers.

Prepayments can be calculated based either on the percentage of the total order or have a fixed amount.

Explanation:

​When testifying at trial, the witness for the plaintiff will undergo _______ by the plaintiff's attorney, and a(n) _______ by defense counsel

Answers

When testifying at trial, the witness for the plaintiff will undergo examination-in-chief by the plaintiff's attorney, and cross-examination by defense counsel.

Examination-in-chief is the initial questioning of a witness by the lawyer who called that witness to testify. During this questioning, the witness provides evidence to support the plaintiff's case.

Cross-examination is the questioning of a witness by the opposing party's lawyer after the witness has completed the examination-in-chief. During cross-examination, the opposing lawyer will ask questions aimed at testing the witness's testimony, challenging the witness's credibility, and undermining the plaintiff's case.

Learn more about Cross-examination here:

https://brainly.com/question/399157

#SPJ4

alice alpha has a long standing grievance against ben beta and had threatened to kill him when alpha saw beta standing on a street corner amidst a crowd of people alpha pulled a gun and fried a shot

Answers

In this case, the main crime committed by Alice Alpha is attempted murder.

What crime did Alice Alpha commit?

In this scenario, Alice Alpha pulled out a gun and fired a shot at Benjamin Beta with the intention to kill him, which constitutes attempted murder. Although she only grazed Beta's arm and did not succeed in killing him, her intention and action to kill Beta meet the criteria for attempted murder under criminal law.

Additionally, Alice Alpha's actions resulted in the unintended consequence of killing Gerry Gamma, which could also result in charges of involuntary manslaughter or negligent homicide, depending on the specific jurisdiction's laws and the circumstances of the incident.

Read more about grievance

brainly.com/question/28890684

#SPJ1

Other Questions
What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily? Which of the following definitions best describes rigor in quantitative research?1. Time frame in which the research takes place2. Degree of aggressiveness used in acquiring the data3. Amount of control and precision exerted by the methodology4. Process used to synthesize findings to form conclusions from a study What profile payload is not available for computers?a) Restrictionsb) Lock Screen Messagec) Maild) Directory Use the given data to find the minimum sample size required to estimate the population proportion.Margin of error: 0.04; confidence level : 99%; from a prior study, p hat is estimated by 0.07. a nonmechanical water meter could u5lize the hall effect by applying a magne5c field across a metal pipe and measuring the hall voltage produced. what is the average fluid velocity in a 3.50- cm-diameter pipe, if a 0.750-t field across it creates a 75.0-mv hall voltage Carter Motor Company claims that its new sedan, the Libra, will average better than 70 miles per gallon in the city. Use , the true average mileage of the Libra. Express the null hypothesis H0 and the alternative hypothesis H1 in symbolic form. What increases as you go deeper into the ocean?A. Pressure, temperature, and densityB. Just pressure and temperatureC. Just densityD. Just temperature and salinity a nurse is caring for a client admitted to the unit for nausea and vomiting who was treated with ondansetron. a friend visiting the client asks the nurse why the client is sleeping. which is the nurse's best response? the scala of the cochlea which houses the actual hearing apparatus Characteristics of human immunodeficiency virus neuropathy include: (Select 2)distal polyneuropathy rapid sudden onset proximal muscle weakness allodynia upper extremities most commonly involved proximal to distal progression of symptoms If cerebral malaria-causing infected erythrocyte in brain venules lost its adhesion to endothelium, it would most likely first flow into which type of blood vessel?a. arteriolesb. veinsc. capillariesd. arteries How can we define entropy using boltzmann's constant? daryl is managing a cross-functional team that often is confined to virtual meetings. he feels like group identity has given way to individual performance measures. what is a practical way that daryl can reorient the team to team goals? THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA? what is the required rate of return on a stock with a beta of 1.9? round your answer to one decimal place. tech a states that a dtc is set if the electrical system of a secondary air injection system fails. tech b states that a check engine light is also illuminated at that instance of component failure. who is correct? solve for particular solution using exponential shift7. (D + 3)'y = 15x2e - 3x 8. (D - 4)'y = 15xe4x 9. DD - 2)2y = 16e2x 10. D'D + 3) y = 9e - 3x 11. (D D 2 y = 18xe" 12. (D? - D - 2)y = 36xe2x Ans.y = 4x'e-3x Ans.y = $x*e** Ans.y = 2x%e2 A hospital ramp for patients is inclined at 25. The height of the ramp is 12 meters. What is the distance a patient will walk on the ramp? Round your answer to the nearest hundredth A DUI conviction will remain on a California driving record for ________ years. If you understand the parts of thinking, you can ask the crucial questions implied by those parts.