Recessive traits are...


visible in the organism's phenotype as long as TWO recessive traits are present.


visible in the organism's phenotype as long as ONE recessive trait is present.

Answers

Answer 1
I don’t really understand this question can you go more into detail

Related Questions

Can someone help me fill in the blanks. Thank you.​

Answers

Answer:

1) fungi

2) tubers

3)bulbs

4) unequally

5) cuttings

6)equally

7)root

8) mitosis

this my knowledge on this questions...hope i helped!

Select the item(s) that describe a producer.

1.takes energy from the sun
2.helps rot dead organisms
3.fungus
4.tall grass
5.food is mostly animal
6.plant eater
multiple choice

Answers

Answer:

3. fungus

4. tall grass

5. food is mostly animal

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC


ste
Class
Lesson Uutine
Levels of Organization
A Lite's Organisation
1. A large animal is composed of trillions of tiny
together
organisms are made of only one cell.
working

Answers

Answer:Life's Organization. 1. A large animal is composed of trillions of tiny cells working together. 2. Unicellular organisms are made of only one cell. B.

Explanation:

The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect does this mutation have on the individual? WILL GIVE BRAINLIEST
The individual suffers from sickle cell anemia.

The individual suffers from myotonic dystrophy.

The individual suffers from Fragile X syndrome.

The individual suffers no negative effects.

Answers

i believe it to be the first one

Answer:

The individual suffers from sickle cell anemia.

Explanation:

Deformed red blood cells occur in 1 in 500 African Americans. This is caused due to a gene mutation called point mutation that alters the structure of the red blood cell. This alteration affects the cell's ability to carry oxygen.

In three to five sentences, construct an argument that shows why lichens are necessary to establish a new ecosystem after an extreme disturbance.
I would really appreciate it if someone o two people would help me out on this one

Answers

Answer:  Lichens affect every species in the ecosystem, in 2013 Russia had a dramatic lichen die off which caused 61,000, 20% of the entire reindeer population to die from starvation. And with fewer deers, the bears and wolves also suffered from the loss of lichens and if it takes a long time for lichens to grow back in an ecosystem, animal declines may take years if ever to be corrected.  Lichens serve as a basis for several food chains, especially in artic communities.

The argument which shows why lichens are necessary to establish a new ecosystem is as follows;

Lichens are known to enable algae to live all over the world in many different climates.

On this note, lichens also provide a means to convert carbon dioxide in the atmosphere through photosynthesis into oxygen, a process required by all to survive.

Additionally, lichens provide us with valuable information about the environment around us.

On this basis, lichens are important for establishing a new ecosystem after an extreme disturbance.

Read more on lichens and the ecosystem;

https://brainly.com/question/1504278

Sister chromatids are ____.. Single choice.

A. dense patches within the nucleus
B. bacterial chromosomes
C. joined strands of duplicated genetic material
D. prokaryotic nuclei
Option 2

Please hellppppp!

Answers

the answer is C i hope it’s right but i searched up

Answer:

C- joined strands of duplicated genetic material

Explanation:

key words duplicated sister

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

Which is the last link in the wetlands food chain?
A. Consumers
B. Predators
C. Decomposers
D. Producers

Answers

It should be C. decomposers

Answer:

BRO THE CORRECT ANSWER IS .... C) DECOMPOSTER

Explanation:

I KNOW IT IS SAME BUT STILL YOU CAN MARK ME AS BRAINIEST

4.Paramecium is able to move by hairlike structures called
____

Answers

Answer:

Cilia

Explanation:

           

The farmer realizes he could sell mini-dragons as pets, but doesn't want them to breathe fire, because that would be dangerous. Suggest two parental genotypes for parents that would produce mini, non-fire breathing dragons.

Answers

Answer:

ddff  and DDFf

Explanation:

From the information given:

Let DD represents the dwarf traits and FF represents the ability for the dragons to breathe fire.

Also, if dd represents the normal traits and ff represents the inability of the dragons to breathe fire.

Then; we can cross a dominant trait for dwarfism which has a heterozygous trait for fire with a recessive trait of normal and nonfire.

The two parental gametes are: ddff  and DDFf

Using a Punnet Square:

         DF              Df

df      DdFf           Ddff

df      DdFf           Ddff

From above; we could observe that the proportion of progenitors that will be dwarf and at the same time unable to breathe fire is 50%.

1. Shivering when you are cold is an example of your body trying to maintain
homeostasis.
a. True
b. False

Answers

Answer:

true

Explanation:

When the core body temperature drops, the shivering reflex is triggered to maintain homeostasis. Skeletal muscles begin to shake in small movements, creating warmth by expending energy. Shivering can also be a response to a fever, as a person may feel cold.

What is often a problem when calibrating a molecular clock?
A. There are frequently not enough negative mutations to accurately calibrate the clocks.
B. There are many different clocks, each of which "ticks" at a different rate.
C. The clocks use mutations that are difficult to identify and track.
D. The frequency of crossing over is used to calibrate the clocks.​

Answers

Answer:

cevabın C olduğunu düşünüyorum

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

A cell is placed in a hypertonic solution. Which will most likely occur as homeostasis is maintained in the cell?

A.
The cell will gain ATP molecules.

B.
The cell will gain water.

C.
The cell will lose water.

D.
The cell will lose sodium ions.

Answers

Answer:

B the cell will lose water

Explanation:

Because of the hypertonic solution water will move on the concentration gradient leaving the cell and entering the solution. Thus the cell looses water.

When a cell is placed in a hypertonic solution, it will most likely lose water (Option C) as homeostasis is maintained in the cell.

What is homeostasis?

Homeostasis is the ability of an organism or a system to maintain a relatively stable internal environment, despite changes in external conditions. It is a key aspect of biology that helps living organisms survive in their environment. Homeostasis is maintained through a series of physiological processes that regulate different aspects of an organism's biology, such as temperature, fluid balance, and pH

A hypertonic solution is one that has a higher concentration of solutes (e.g. salts) outside the cell compared to inside the cell. This creates an osmotic pressure gradient, which draws water out of the cell and into the solution in an attempt to balance the concentration of solutes on both sides of the cell membrane. As a result, the cell will shrink and lose water.

Learn more about homeostasis, here:

https://brainly.com/question/29776080

#SPJ6

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

Put "Genetic Variation" in a sentence

Answers

Answer: British populations lack detectable genetic variation, suggesting a strong founder effect.

hope it will be helpful.

Mutations can often cause genetic variation.


Hope that helps!

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

PLS HELP ILL MARK BRAILIEST
Spend one minute writing an explanation of
the FUNCTION of enzymes. YOU MUST USE
THE WORDS CATALYST, ACTIVATION
ENERGY, RECYCLABLE

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions. Activation energy is the energy needed to start a chemical reaction. This is illustrated in Figure below. The biochemical reaction shown in the figure requires about three times as much activation energy without the enzyme as it does with the enzyme.

The reaction represented by this graph is a combustion reaction involving the reactants glucose (C6H12O6) and oxygen (O2). The products of the reaction are carbon dioxide (CO2) and water (H2O). Energy is also released during the reaction. The enzyme speeds up the reaction by lowering the activation energy needed for the reaction to start. Compare the activation energy with and without the enzyme

Answer:

Enzymes help speed up chemical reactions in the human body. They bind to molecules and alter them in specific ways. They are essential for respiration, digesting food, muscle and nerve function, among thousands of other roles.

What is the function of an enzyme? They allow chemical reactions to occur at normal body temperature fast enough to sustain life. They reduce the activation energy needed to start a chemical reaction.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

Enzymes create chemical reactions in the body. They actually speed up the rate of a chemical reaction to help support life. The enzymes in your body help to perform very important tasks. These include building muscle, destroying toxins, and breaking down food particles during digestion.

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

Please help due in 10 minutes!!!
Explain the 5 ways to reach Hardy-Weinberg equilibrium, does this mean evolution is occurring?

Answers

There are five basic Hardy-Weinberg assumptions: no mutation, random mating, no gene flow, infinite population size, and no selection. If the assumptions are not met for a gene, the population may evolve for that gene (the gene's allele frequencies may change).

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

SOMEONE PLEASE ANSWER OMG



Considering that different types of cells have different rates of mitosis,
which of the following would be a correctly finish this statement? Cell
types like skin and hair are damaged and need replaced more often than
liver cells; therefore ......
Liver cells would have MORE cells doing Mitosis and Apoptosis compared to
Skin/Hair cells
Liver cells would have LESS cells doing Mitosis and Apoptosis compared to Skin/Hair
cells
Liver cells would have the SAME amount of cells doing Mitosis and Apoptosis
compared to Skin/Hair cells

Answers

Answer:

OMGGGGHHHHVGGGGGGGGG

Other Questions
On January 1, 2019, Cullumber Corporation acquired machinery at a cost of $1650000. Cullumber adopted the straight-line method of depreciation for this machine and had been recording depreciation over an estimated life of ten years, with no residual value. At the beginning of 2022, a decision was made to change to the double-declining balance method of depreciation for this machine. Assuming a 30% tax rate, the cumulative effect of this accounting change on beginning retained earnings, is The relation between people and institutions can be cordinal and sustianable if internal conflict is immediately solved. Justify the statement Look at the graph below: First line joins ordered pairs negative 4, 3 and 2, negative 3. Second line joins negative 4, negative 3 and 2, 3. Part A shaded above first and second line. Part B shaded below first line and above second line. Part C shaded below first and second lines. Part D shaded above first line and below second line. Which part of the graph best represents the solution set to the system of inequalities y x + 1 and y + x 1? (5 points) Question 10 options: 1) Part A 2) Part B 3) Part C 4) Part D Maria rents a bicycle while on vacation. It costs a flat fee of $19.95 plus $5.50 an hour. Maria rents it for 4 hours. What is the total cost? 100 POINTS + BRAINLIEST PLEASE HELP ME A triangular prism where the base is a right traingle with lengths of the edge are given 3cm,4cm,5cm,3cm what are the total surface Find the surface area of the rectangular prism with a length of 3 cm, a width of 2 cm, and a height of 6 cm I need help ASAP pleaseeeeee El largo de una sala es 2 metros ms grande que su ancho. El rea es de 80 m?. Cunto mide de largo? Cunto mide de ancho? bro please help me ill give brainliest to the first one to answer correctly. its for some iready assessment Josefina fue al banco para cambiar un cheque de $5000. La cajera le entreg 39billetes, unos eran de $100 y otros de $200; Cuntos billetes de $100 y cuantos de$200 recibi Josefina? please Help me i'm timed Simplify the expression:5k2+3k24k2+k2 Whats the volume of this cube? Which of the following caused the Phoenicians to rely upon the sea for travel and trade? 2Find the quotient when x + 11x + 18 is divided byx +9 if you were 21 years old in 1960, you would have had the legal right to vote in national elections unless you wereAfrican American.a member of Congress.a resident of Washington, D.C.female. Solve the equation. n/10+8=15 The Manda Panda Company uses the allowance method to account for bad debts. At the beginning of 2009, the allowance account had a credit balance of $75,000. Credit sales for 2009 totaled $2,400,000 and the year-end accounts receivable balance was $490,000. During this year, $73,000 in receivables were determined to be uncollectible. Manda Panda anticipates that 3% of all credit sales will ultimately become uncollectible. The fiscal year ends on December 31.Required:1. Does this situation describe a loss contingency? Explain.2. What is the bad debt expense that Manda Panda should report in its 2009 income statement?3. Prepare the appropriate journal entry to record the contingency.4. What is the net realizable value (book value) Manda Panda should report in its 2009 balance sheet? PLEASE I WILL GIVE BRAINLIEST Select the correct answer.When is a secondary source of information necessary to support a thesis statement?A. when the student wishes to make the literary analysis essay more interestingB. when the student wants to explore outside influences on a literary workC. when the student wishes to find additional information about the charactersD. when the student wants to ensure that the sources used in the essay are reliable