Please help me with this

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

Explanation:

While individual plant species are unique, all share a common structure: a plant body consisting of stems, roots, and leaves. They all transport water, minerals, and sugars produced through photosynthesis through the plant body in a similar manner. All plant species also respond to environmental factors, such as light, gravity, competition, temperature, and predation.

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

Answer:

Increases.

Explanation:

A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.

Answer:

Leech

Explanation:

leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.

Answer:

a leech i got it correct on edu!

Explanation:

Answer:

the day would get shorter.

hope it helps.

Answer:

year would get longer

Explanation:

Answer:

Advantages of following the soft path, the argument here is alternative sources of power such as hydropower, geothermal energy , wind energy , and photovoltaic cells must be developed. This provides a alternative source to remain in a healthy environment and also function as the society we currently live in using the hard path.  Disadvantages of following the hard path result with future generations fearing over the irreversible damage of climate change and the damage done to our atmosphere. The hard path argue that we should continue to operate in the future as we have in the past, except more efficiently. This is close to impossible and will only continue the negative effects the hard path( the path we have been following) results in. The major shift determines the outcome of this world, the futures worries or reliefs and ultimately the survival of humans.

Explanation:

Answer:

Surface mining is the extraction of mineral and energy resources near Earth's surface by first removing the soil, subsoil, and overlying rock strata. ... Surface mining disturbs the land more than subsurface mining, but subsurface mining is more expensive and dangerous.

Explanation:

Answer: A species that was unable to adapt and died out

Explanation: Good luck! :D

Answer:

the last answer

Explanation:

because f,g,h both come from a so you can be sure

Answer:

i think the answer is c roundworms

Explanation:

i know im right becausee i made a 90% with this being right

Answer:

a roundworm

Explanation:

I got the answer right on quiz .

Answer:

i think its a turnip because of its appearance

Answer:

movement of a solute from an area of high concentration to an area of low concentration

Explanation:

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

Answer:

A

Explanation:

classified as tundra biomes

Answer:

Genotypes: A man with hemophilia is XhY where h = hemophilia gene and H = the normal gene. ... Her genotype must be: XhXH and NOT XHXH We can use a Punnett square to show the probability of a daughter or son having hemophilia.

The correct answer is C. Gardeners choose which plants they let reproduced based on the plant traits.

Explanation:

In general, selective breeding involves the intervention of humans in the reproduction of species, this includes mainly plant and animal species. Moreover, in selective breeding, humans choose which specific species or individuals reproduce to favor certain traits. For example, a farmer might allow only the biggest cows to reproduce because this will lead to bigger calves. In this context, the option that shows selective breeding is C because this shows the intervention of humans in reproduction by selecting the individuals that will reproduce.

Answer:

Birds

Explanation:

1. Wings

2. Flight feathers and beak

3. For survival purposes

Answer:

gotchu

Explanation:

1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)

2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal

b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster

3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.

4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women

5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD

6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids

Answer:

I agree with the other person

have a good day :)

Explanation:

Answer:

I hope this helps

Explanation:

As animals move, their hooves break up the soil, compacting inedible plants and allowing nutrients and sunlight to new plants—essentially speeding up the building of soil organic matter, with crushed leaves and stalks creating a natural mulch. This better equips the soil for germinating seeds.

Answer:

maybe they think it will make them magical?

Explanation:

Answer:

a normal cell contains 46 chromosomes whereas HeLa cells contain 76 to 80 (ref) total chromosomes, some of which are heavily mutated (22-25), per cell.

Explanation:

The main difference between Hela cells from other human cells is that a normal cell contains 46 chromosomes whereas HeLa cells contain 76 to 80 (ref) total chromosomes, some of which are heavily mutated (22-25), per cell.

The involvement of hela made to the developing field of genetics is a lot was educated about cell reproduction, DNA and mapping genetics. The hela cells prepared them ideal for use in the polio vaccine trials because they were more liable than other cultured cells.

Cancer cells such as Hela cells escape to normal cell cycle by mutations that lead to the misexpression and/or overexpression of regulatory molecules (e.g., cyclins and cyclin-dependent kinases) and faulty checkpoint control of the cell cycle.

The control of the cell cycle depends on 1-cyclins and cyclin-dependent kinases (CDKs) that regulate the cell cycle by a cascade of protein phosphorylations and 2- a group of checkpoint controls that monitor the completion of critical cellular events.

Therefore, The main difference between Hela cells from other human cells is that a normal cell contains 46 chromosomes whereas HeLa cells contain 76 to 80 (ref) total chromosomes, some of which are heavily mutated (22-25), per cell.

Learn more about chromosomes on:

https://brainly.com/question/1596925

#SPJ2

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

Answer:

Hello! Your answer is...

The lithosphere is the rocky outer part of the Earth. It is made up of the brittle crust and the top part of the upper mantle. The lithosphere is the coolest and most rigid part of the Earth. The crust is the layer that you live in. The Outer and Inner Cores are hotter. The temperatures of the crust vary from air temperature on top to about 1600. The asthenosphere is the part of the mantle that flows and moves the plates of the Earth.

Explanation:

Hope this helps you! I'm new, but am really smart and nice. Hope you enjoy your time on brainly!

The crust of the Earth, the uppermost layer visible in a cross-section of the planet, is halfway through at this point. The crust, which only accounts for around 1% of the Earth's total volume, is made up of igneous, metamorphic, and sedimentary rocks.

The rocky exterior of the Earth is known as the lithosphere. It is composed of the uppermost layer of the upper mantle and the brittle crust. You live in the crust of the earth. It is hotter in the outer and inner cores.

The crust varies in temperature from the top air temperature to roughly 1600. The Earth's tectonic plates are moved by the asthenosphere, a region of the mantle.

Therefore, Mantle Crust layer of the Earth does the upper surface of the cross-section represent.

Learn more about Earth here:

https://brainly.com/question/14491367

#SPJ2

Answer:

B. Midbrain

Explanation:

I'm pretty sure this is it.

Answer:

Smooth Muscle

Explanation:

In the digestive tract it's called the muscularis mucosa.