Please explain the REFORM of St. Thomas Aquinas EconomicIdeas

Answers

Answer 1

The REFORM of St. Thomas Aquinas Economic Ideas refers to the adjustments that were made to the economic theories of St. Thomas Aquinas during the medieval period. Aquinas was a renowned theologian and philosopher who wrote extensively on economics, but his ideas were often misinterpreted and misapplied.


The reform of Aquinas' economic ideas began in the 14th century with the work of theologians such as William of Ockham, who sought to clarify and refine Aquinas' theories. They argued that Aquinas' focus on the common good and social justice was often overshadowed by his emphasis on private property and market forces.

As a result, the reformers sought to reconcile Aquinas' ideas with the principles of Christian ethics and social justice. They emphasized the importance of fair distribution of wealth and the protection of the poor, and challenged the idea that market forces alone could ensure economic prosperity.

Overall, the reform of Aquinas' economic ideas was an important step in the development of medieval economic thought, and contributed to the emergence of a more nuanced and socially conscious approach to economics.

Learn More about St. Thomas Aquinas Economic Ideas here :-

https://brainly.com/question/31530516

#SPJ11


Related Questions

The EEOC's definition of race and color encompasses all of the following, except:
Physical characteristics
Gender
Ancestry
Association

Answers

The EEOC's definition of race and color encompasses all of the following, except Gender.

When someone is treated unfairly due to their race or other racial-related features, this is referred to as race discrimination. When someone is treated unfairly due to their skin tone or color, this is called color discrimination. Being treated poorly because to a person's marriage to (or affiliation with) a member of a certain race or color is another kind of race or color discrimination.

When the victim and the perpetrator share the same racial or ethnic background, prejudice may have taken place. The statutes enforced by the EEOC prevent employers from treating you differently or less favorably because you, an acquaintance, a parent or caregiver, or another individual you associate with is of a specific race or color.

Therefore the correct answer is option B.

Learn more about Race here:

https://brainly.com/question/28138343

#SPJ4

during a recent lengthy strike at morell manufacturing company, management replaced striking assembly line workers with office workers. the assembly line workers had been paid $18 per hour while the office workers are only paid $10 per hour. what is the most likely effect on the labor variances in the first month of this strike?

Answers

The replacement of higher-paid assembly line workers with lower-paid office workers during a strike at Morell Manufacturing Company is likely to result in a favorable labor rate variance in the first month of the strike. This is because the company will be paying lower hourly rates for the workers during the strike, resulting in lower labor costs per unit produced.

The use of lower-paid office workers in place of the higher-paid assembly line workers during the strike is likely to result in favorable labor variances in the first month.

The labor rate variance is expected to be favorable, reflecting the cost savings of paying the lower wage rate. However, the labor efficiency variance may be unfavorable if the office workers are not as productive as the assembly line workers, resulting in lower production levels.

To know more about labor rate:

https://brainly.com/question/29638804

#SPJ4

alicia has had an excellent driving record for three years, so she received a 30% discount on her auto insurance. which of these is exemplified by the discount?

Answers

The discount that Alicia received on her auto insurance is an example of how insurance companies use risk assessment to determine premiums.

Insurance companies collect data on their policyholders, including their driving record, age, gender, and location, to evaluate the likelihood that they will file a claim. Based on this risk assessment, the insurance company determines the premium that the policyholder will pay.

In Alicia's case, her excellent driving record over the past three years indicated to the insurance company that she is a low-risk driver, and therefore less likely to file a claim. As a result, the insurance company offered her a discount on her premium. This is an example of how the insurance industry uses risk assessment to determine premiums, and reward low-risk policyholders with discounts.

Overall, the discount that Alicia received is an example of how insurance companies incentivize policyholders to maintain good driving habits and low-risk behaviors. By offering discounts to low-risk policyholders, insurance companies are able to maintain profitability while providing affordable coverage to their customers.

For more such questions on insurance

https://brainly.com/question/25855858

#SPJ11

Explain and evaluate how impairment and revlation of PP&E and intangible assets affect financial statments and ratios - Impairment

Answers

Impairment of PP&E and intangible assets refers to a reduction in their carrying value due to a decline in their recoverable amount. This affects financial statements by reducing their reported value and can impact ratios like profitability and solvency negatively.

Financial statements and ratios can be significantly impacted by the depreciation of property, plant, and equipment (PP&E) and intangible assets. When an impairment happens, these assets' carrying values are decreased, resulting in lower reported values on the balance sheet, which can affect profitability measures like return on assets (ROA) and return on equity (ROE).

Impairment losses are also frequently shown as costs in the income statement, which can reduce net income and have an impact on metrics like earnings per share (EPS) and profit margins. Impairment may often hurt financial statements and ratios, signalling possible financial difficulties for a corporation.

Learn more about intangible assets:

https://brainly.com/question/29704120

#SPJ4

in which of the following circumstances would the use of the negative form of accounts receivable confirmation most likely be justified? multiple choice a small number of accounts may be in dispute and the accounts receivable balance arises from sales to many customers with small balances. a substantial number of accounts may be in dispute and the accounts receivable balance arises from sales to many customers with small balances. a substantial number of accounts may be in dispute and the accounts receivable balance arises from sales to a few major customers. a small number of accounts may be in dispute and the accounts receivable balance arises from sales to a few major customers.

Answers

The use of the negative form of accounts receivable confirmation would most likely be justified in the circumstance where a small number of accounts may be in dispute and the accounts receivable balance arises from sales to many customers with small balances.

In this situation, the negative form of confirmation is appropriate because it is efficient for confirming a large number of accounts with small balances. The negative form requires the customer to respond only if there is an issue or disagreement with the balance stated, reducing the time and effort needed for customers with accurate balances.

Since there are only a small number of accounts in dispute, the risk of receiving incorrect confirmations is relatively low. Additionally, the substantial number of customers and small balances make it less likely that any single disputed account would have a material impact on the overall financial statements.

To recap, the negative form of accounts receivable confirmation is most likely justified when:


1. A small number of accounts are in dispute.
2. The accounts receivable balance arises from sales to many customers.
3. The customers have small balances.

To know more about confirmation refer home

https://brainly.com/question/14175043#

#SPJ11

What is the statistic that measures the direction and strength of the linear relationship between two variables?-Coefficient of variation -r-square -Coefficient of kurtosis -Correlation coefficient -Variance

Answers

The correlation coefficient is a metric that assesses the direction and magnitude of the linear connection among two variables.

What city is coefficient in?

The multiplicative numbers that are placed right in front a particular variable, such x or y, are known as coefficients. A number in a formula that is not linked to a variable is not regarded as a coefficient.

A coefficient example is what?

a multiplier that is used on a variable. Example: Since "z" constitutes a variable, the term "6z" refers to the product of 6 and z.

To know more about coefficient visit:

https://brainly.com/question/29891271

#SPJ1

A linear programming problem contains a restriction that reads​ "the quantity of Q must be no larger than the sum of​ R, S, and​ T." Formulate this as a linear programming constraint.

Answers

To formulate this restriction as a linear programming constraint, we can use the following equation:

Q ≤ R + S + T

This constraint ensures that the quantity of Q does not exceed the sum of R, S, and T. It is important to note that linear programming problems involve optimizing a linear objective function subject to linear constraints, and this constraint satisfies the linearity requirement.

to know more about the linear programming constraint:

https://brainly.com/question/19559799

#SPJ11

True or False: Recruiting is important in fulfilling the company's equal employment opportunity commitments.

Answers

The statement “recruiting is important in fulfilling the company's equal employment opportunity commitments” is true because the company has the opportunity to attract a diverse pool of candidates and ensure that the selection process is fair and impartial.

Companies have a legal and moral obligation to provide equal employment opportunities to all applicants, regardless of their race, gender, age, or other protected characteristics.

The recruiting process, therefore, should be designed to eliminate any biases and barriers that might prevent qualified individuals from applying for the job. By actively seeking out diverse candidates and providing equal access to job opportunities, companies can create a more inclusive workplace that reflects the communities they serve, the statement is true.

To learn more about recruiting follow the link:

https://brainly.com/question/30086296

#SPJ4

A private firm is about to provide a public good. The firm estimates that its planned annual expenditures will be $50,000,000$⁢50,000,000. The total quantity demanded of the good is estimated to be 250,000250,000 units per year. Since the good is nonexcludable, the share demanded by free riders is estimated to reach 60%60% of the total quantity demanded.
To cover its costs, how much should the firm charge for each unit consumed by paying customers? Enter your answer in the box below and round to the nearest whole number if necessary.

Answers

The firm still needs to generate another $10,000,000 to cover its costs. This could potentially come from government

subsidies

or donations, as the good is nonexcludable and therefore benefits society as a whole.

If the

firm

should charge $400 per unit to the 100,000

paying

customers, that will generate $40,000,000 in revenue ($400 x 100,000 units).



Since the total quantity

demanded

is 250,000 units and 60% of that will be demanded by

free riders

, that means the firm can only expect to

sell

100,000 units to paying

customers

(40% of 250,000).

To cover its

costs

of $50,000,000, the firm needs to generate $50,000,000 in revenue.

So, if the firm charges $400 per unit to the 100,000 paying customers, that will

generate

$40,000,000 in revenue ($400 x 100,000 units).

Learn More about

subsidies

here :-

https://brainly.com/question/17136613

#SPJ11

If a Method A has a MAD of 1.4 and a tracking signal of -5 what can be interpreted by this information?-The forecast method is working fine. -The tracking signal should be negative. -Cannot be determined. -The tracking signal should be positive. -The forecast method should be reviewed.

Answers

The forecast method is working fine can be interpreted by this information. The answer is OPTION A

To interpret anything is to convey knowledge to another person. To interpret anything is to comprehend its intended meaning. To interpret anything is to ponder something you have read. The third stage of perception is called interpretation, and it involves giving meaning to our experiences through the use of mental models called schemata.

Schemata function as databases of linked information that we store and utilize to comprehend novel events. You determine that this is the importance or meaning of something if you interpret it in a certain way. They had made the decision to come, and that was seen as a good omen. The judge correctly notes that he must apply the law's current interpretation.

To learn more about interpret, click here.

https://brainly.com/question/30932003

#SPJ4

you own a stock portfolio invested 20 percent in stock q, 18 percent in stock r, 5 percent in stock s, and 57 percent in stock t. the betas for these four stocks are 1.2, .4, 1.3, and .8, respectively. what is the portfolio beta? (do not round intermediate calculations. round your answer to 3 decimal places.)

Answers

The portfolio beta is a measure of the overall risk of a portfolio in comparison to the market. To calculate the portfolio beta, you need to know the proportion of each stock in the portfolio and their respective betas. In this case, portfolio beta is 0.813

In your case, you have provided the following information:
- Stock Q: 20% investment and beta of 1.2
- Stock R: 18% investment and beta of 0.4
- Stock S: 5% investment and beta of 1.3
- Stock T: 57% investment and beta of 0.8



To find the portfolio beta, you need to multiply the percentage investment of each stock by its respective beta, and then add these products together: Portfolio Beta = (0.20 x 1.2) + (0.18 x 0.4) + (0.05 x 1.3) + (0.57 x 0.8)
Portfolio Beta = (0.24) + (0.072) + (0.065) + (0.456) = 0.813



Therefore, the portfolio beta is 0.813 (rounded to three decimal places). This value indicates that the portfolio's risk is relatively close to the market risk, since a beta of 1 would represent a perfect correlation with the market. A lower beta implies lower risk, while a higher beta indicates higher risk. In this case, the portfolio has a moderate level of risk exposure, which can be helpful for investors in understanding the potential risks and returns associated with their investment.

Know more about portfolio beta here:

https://brainly.com/question/18760065

#SPJ11

outback corp. recorded sales of $1,300,000 during the current period, in addition the company's accounts receivable balance grew from $120,000 at the beginning of the period to $165,000 at the end of the period. how much cash did outback collect from customers during the period? a. $1,255,000 b. $1,345,000 c. $1,300,000 d. $1,135,000

Answers

The outback collect from customers during the period is $1,255,000. Therefore the correct option is option D.

We must first identify the change in accounts receivable balance in order to calculate the cash collected from consumers throughout the period.

Accounts receivable change = ending receivable balance - beginning receivable balance

Accounts receivable change = $165,000 - $120,000

Accounts receivable change = $45,000

The change in accounts receivable balance shows the increase in credit sales that have not yet been collected in cash during the period. To determine the cash obtained from customers, we must remove this difference from the total sales for the time.

Cash collected from clients = Total sales - Accounts receivable change

Customer cash obtained = $1,300,000 - $45,000

$1,255,000 in cash collected from customers

As a result, the correct option is option D.

For such more question on customers:

https://brainly.com/question/1286522

#SPJ11

according to the manufacturing-based definition of quality: group of answer choices quality lies in the eyes of the beholder. quality depends on how well the product fits patterns of consumer preferences. even though quality cannot be defined, you know what it is. quality is the degree to which a specific product conforms to standards. quality is the degree of excellence at an acceptable price and the control of variability at an acceptable cost.

Answers

According to the manufacturing-based definition of quality, quality is the degree to which a specific product conforms to standards. This means that the quality of a product is determined by how well it meets established standards and specifications. The correct option is d.

In this definition of quality, there is an emphasis on the control of variability at an acceptable cost. This means that manufacturers need to produce products that meet certain quality standards consistently and efficiently, without incurring high costs.

Achieving this requires a focus on process improvement, quality control, and continuous monitoring of production processes.Contrary to the popular saying that "quality lies in the eyes of the beholder," the manufacturing-based definition of quality implies that quality is objective and measurable.

It is not simply a matter of personal preference, but rather a set of standards and criteria that can be evaluated and verified.In summary, the manufacturing-based definition of quality is focused on meeting established standards and specifications, controlling variability, and producing products that are reliable, durable, and cost-effective. It is a more objective and measurable approach to quality, rather than relying solely on subjective opinions or consumer preferences.The correct option is d.

For more such questions on manufacturing

https://brainly.com/question/1082619

#SPJ11

You are the project lead overseeing a project to create a new wireless media streaming device. The working model has been created and you are meeting with the project sponsors to ensure that it meets the requirements. Which tool or technique should be used?

Answers

One useful tool or technique to use in this situation is a requirements traceability matrix.

A traceability matrix is a document, typically in the form of a table, used in software development to compare any two base lined documents utilising a many-to-many relationship in order to determine the completeness of a relationship.

This matrix allows you to track and ensure that each requirement has been met in the working model of the wireless media streaming device. By using this tool, you can provide a clear and organized way to communicate with the project sponsors about the progress of the project and how it aligns with their desired outcomes. Additionally, it can help you identify any gaps in the project's requirements and ensure that they are addressed before the final product is delivered.

To learn more about Traceability matrix, click here:

https://brainly.com/question/29609644

#SPJ11

in order to more easily compare results across years, what should happen when a change in accounting principles is made?

Answers

When a change in accounting principle is made, it can affect the comparability of financial information between different periods.

To address this issue, it is important to disclose the change in accounting principle in the financial statements, along with a detailed explanation of the reason for the change, the method of applying the change, and the effect of the change on the financial statements.

Restating the financial statements of prior periods to reflect the change in accounting principles can also help to improve comparability. By taking these steps, investors and other stakeholders can more easily compare financial results over time and make informed decisions based on consistent and reliable financial information.

To learn more about financial follow the link:

https://brainly.com/question/29641948

#SPJ4

When EU farmers end up with "mountains of butter" and "lakes of wine and olive oil," what of who usually gets the blame?

Answers

When EU farmers end up with "mountains of butter" and "lakes of wine and olive oil," the blame is often attributed to the Common Agricultural Policy (CAP) of the European Union, which is the agricultural policy framework that governs farming and rural development within the EU.

The CAP, which was established in the 1960s, has been criticized for its market intervention mechanisms, including price supports, production quotas, and export subsidies, which were implemented to stabilize agricultural markets, ensure food security, and support farmers' incomes.

However, these mechanisms have also been blamed for creating surpluses or "mountains" and "lakes" of agricultural products, particularly butter, wine, and olive oil, due to overproduction.

When such surpluses occur, they can lead to imbalances in the supply and demand of agricultural products, resulting in lower prices and reduced incomes for farmers. The surplus products can also call for pricey storage or disposal procedures, further taxing the EU and its member states' financial resources.

However, debates and discussions about the effectiveness and impact of the CAP continue, and the issue of surplus agricultural products remains a contentious one in EU agricultural policy and decision-making processes.

To know more about  Common Agricultural Policy refer here:-

https://brainly.com/question/30616255#

#SPJ11

You are a project manager working for the healthcare system and have been tasked with overseeing the implementation of a new computer infrastructure at the local hospital. You are engaged with the Control Scope process. Which tool or technique is being used during this process?AnswersA. Resource levelingB. Milestones listC. Variance analysisD. Inspection

Answers

The tool or technique that is being used during the Control Scope process is variance analysis.

This process is a part of the Project Scope Management knowledge area, which involves defining, validating, and controlling the project scope. Control Scope is the process of monitoring the status of the project scope and managing changes to the scope baseline. The main objective of this process is to ensure that the project stays on track and meets its defined scope.
Variance analysis involves comparing the actual performance of the project to the planned performance, and identifying any deviations or variances. This helps the project manager to identify any potential issues or risks and take corrective action to address them. In the context of the healthcare system's new computer infrastructure implementation, variance analysis would involve monitoring the progress of the project against the defined scope, and identifying any deviations from the planned schedule, budget, or scope. This could include identifying any issues with hardware or software installation, data migration, or user acceptance testing.
By using variance analysis during the Control Scope process, the project manager can ensure that the project stays within the defined scope, and any changes or deviations are managed effectively. This will help to ensure that the new computer infrastructure is implemented successfully and meets the needs of the hospital and its staff.

Learn more about budget :

https://brainly.com/question/15683430

#SPJ11

true or false: the futures market is a niche piece of the overall securities market and is therefore not actively traded or of sufficient size to warrant much interest from investors. true false question. true false

Answers

The given statement is true because the futures market is a significant part of the overall securities market and is actively traded by investors.

In fact, the futures market is one of the largest markets in the world, with billions of dollars worth of contracts traded every day. Futures contracts allow investors to hedge their risks against price movements in various asset classes, including commodities, currencies, and financial instruments.

This makes the futures market an essential tool for businesses and investors to manage their financial risk. In addition, the futures market also provides opportunities for speculators to profit from price movements, adding to the liquidity and depth of the market. Therefore, the futures market is a crucial component of the global financial system and is actively traded by investors of all types.

For more such questions on investors visit:

https://brainly.com/question/25790997

#SPJ11

John and Jane decide to go on a vacation. As a result, they withdraw $2,500 from their savings account. As a result of this transfer by itself
a. M1 increases by $2,500 and M2 decreases by $2,500.
b. M1 increases by $2,500 and M2 stays the same.
c. M1 decreases by $2,500 and M2 stays the same.
d. M1 decreases by $2,500 and M2 decreases by $2,500.

Answers

According to the question A. M1 increases by $2,500 and M2 decreases by $2,500. When John and Jane withdraw $2,500 from their savings account, M1 increases because it measures the total amount of currency in circulation.

What is currency?

Currency is defined as money in any form when in actual use or circulation as a medium of exchange, especially circulating paper money. Currency is a generally accepted form of money, including coins and paper notes, which is issued by a government and circulated within an economy. Currency is used as a medium of exchange to facilitate the trade of goods and services and is used as a store of value. Currency is also a unit of account, which allows for the valuation of goods, services, and debts.

This increase is offset by a decrease in M2, which measures all forms of money, including savings accounts.

Therefore, the correct option is A.
To learn more about currency
https://brainly.com/question/28346152
#SPJ1

In business communication, the main purpose of a 10-K report is to? 1. inform.2. persuade.3. build goodwill.4. build an image.5. maintain a record.

Answers

In business communication, the main purpose of this promote goodwill report's primary goal is to inform, and its secondary goal is to advance goodwill. The correct answer is 3. build goodwill.

Promoting goodwill is a strategy for fostering feelings of positivity and understanding between individuals, groups, and companies. It's frequently seen as a crucial stage in developing long-lasting connections and networks.

Several strategies can be used to promote goodwill, including as customer service, philanthropic work, community service, and marketing initiatives. The main goals of sending business messages are to inform recipients, foster goodwill, influence them to take action, and establish connections and networks.The report educates readers about the company's charity endeavours by disclosing information about its attempts to give back to the community. The report also contributes to the promotion of goodwill towards the Company and its mission by emphasising these efforts.

To know more about Promote goodwill visit:

https://brainly.com/question/30270050

#SPJ4

In today's culture, Muslims seem to be facing more discrimination than other religious groups. What seems to be a cause for this increase?
Their beliefs
Their manner of dress
The change in immigration patterns and the events of 9/11
Their religious practices

Answers

The increase in discrimination against Muslims in today's culture appears to be largely caused by the change in immigration patterns and the events of 9/11.

Following the terrorist attacks on September 11, 2001, many individuals in the United States began to associate Islam with terrorism, leading to negative attitudes and discriminatory behavior towards Muslims.

Additionally, the rise of anti-immigrant sentiment and policies has targeted Muslims and individuals from Muslim-majority countries, further exacerbating the discrimination they face. While some may argue that Muslim beliefs, manner of dress, or religious practices contribute to discrimination, the root cause appears to be a combination of societal perceptions and government policies.

Efforts to combat discrimination against Muslims involve education and awareness-raising campaigns, as well as policy changes aimed at promoting diversity, inclusion, and equal treatment for all individuals regardless of their religion.

To know more about  immigration patterns, refer here:
https://brainly.com/question/16796369#
#SPJ11

sales revenue is forecasted to grow by 9% next year, forecasted net income is expected to be $35,000, and all current assets and current liabilities vary proportionally with sales. if $40,000 worth of net noncurrent assets are required to be purchased next year, what is the external financing needed? assume that the company does not pay dividends, and that all noncurrent liabilities and equity (except retained earnings) will be the same level as the current year.

Answers

The company will need $5,000 in external financing to achieve its growth objectives and maintain its current financial structure.

How to calculate the external financing needed

Sales revenue is projected to increase by 9% next year, leading to an anticipated net income of $35,000.

With current assets and current liabilities varying proportionally with sales, it is essential to consider the impact of this growth on the company's financial position.

Additionally, the company plans to purchase $40,000 worth of net noncurrent assets next year.

External financing needed can be calculated by considering the increase in assets and the increase in retained earnings (net income), while keeping noncurrent liabilities and equity constant.

Since the company does not pay dividends, all net income is retained.

To determine the external financing needed, subtract the increase in retained earnings ($35,000) from the required net noncurrent assets purchase ($40,000):

$40,000 (net noncurrent assets) - $35,000 (retained earnings) = $5,000

Hence, The answer is $5000.

Learn more about sales revenue at

https://brainly.com/question/21290956

#SPJ11

physical counts of inventory: are used to adjust the inventory account balance to the actual inventory available. must be taken at least once a month. requires the use of hand-held portable computers. are not necessary under the cost-to benefit constraint. are not necessary under the perpetual system.

Answers

Physical counts of inventory are used to adjust the inventory account balance to the actual inventory available. Therefore the correct option is option A.

They are usually performed on a regular basis, such as once a year or once a quarter, to ensure that the inventory account accurately reflects the quantity and value of products on hand.

While physical inventory counts are not mandated by law, they are a typical practise in most businesses to confirm the accuracy of the inventory account balance.

Physical inventory counts do not always necessitate the use of handheld portable computers, while such devices can serve to streamline the counting process. Therefore the correct option is option A.

For such more question on inventory:

https://brainly.com/question/28155287

#SPJ11

In doing business with China, U.S. businesses should understand that there is a strong influence of ______.
A. Hinduism
B. Judaism
C. Islam
D. Christianity
E. Confucianism

Answers

In doing business with China, U.S. businesses should understand that there is a strong influence of Confucianism.

The correct answer is:- E

Confucianism has been a dominant philosophy and cultural influence in China for thousands of years, emphasizing values such as respect for authority, strong work ethic, and group harmony. Understanding these values and how they impact business practices can be crucial for successful business dealings in China.

For example, Confucianism places a strong emphasis on respect for authority and seniority, which can affect business relationships and decision-making processes in China.

Confucianism also emphasizes the importance of maintaining social harmony and avoiding conflict, which can impact negotiation styles and conflict resolution approaches in Chinese business dealings.

Understanding the influence of Confucianism can be important for U.S. businesses when engaging in business with China, as it can help them navigate cultural nuances, build effective relationships, and adapt their business practices to be more aligned with Chinese cultural values.

It's important to note that while Confucianism has a significant influence on Chinese business culture, it is not the only factor, and other cultural, social, and economic factors also play a role in shaping China's business environment.

To know more about Confucianism refer here:-

https://brainly.com/question/12078628#

#SPJ11

A/an ____ is a grouping of tasks, duties, and responsibilities that constitutes the total work assignment for employees.A. AssignmentB. positionC. employment specificationD. job

Answers

Option d: A/an job is a grouping/group of tasks, duties, and responsibilities that constitutes or comprises the total/complete work assignment for employees.

Job can be further described as -

- Full-time or part-time paid positions are sometimes referred to as "jobs".

-  Goods that are usually sold at a set price.

- Specific tasks that people perform as a regular part of their work.

-  Liability or Obligation.

When a position becomes vacant, companies try to fill it internally or externally. It starts with writing a job description outlining all of the individual jobs. The description also includes information about payment, benefits, requirements, etc. The description is included in the ad. Advertisements may be posted on internal bulletin boards or in external publications and recruitment agencies.

To learn more about job, here:

https://brainly.com/question/29802928

#SPJ4

What is the tracking signal for method A? MAD is 1.4Period Actual Method A Method B1 10 10 92 8 11 103 12 12 84 11 13 125 12 14 11

Answers

In statistics and management science, a tracking signal keeps track of any predictions that have been made and compares them to the results, alerting the user when unexpected deviations from the predictions occur.

Forecasts can be made for inventories, revenue, or any other aspect of future demand for a company. The ratio of Cumulative Error divided by Mean Absolute Deviation is used to calculate Tracking Signal. The TS might also be positive or negative depending on whether the cumulative error is positive or negative.

A tracking signal is the ratio of the mean absolute deviation to the total sum of the variances between the projected forecasts and the actual values.

To learn more about management, click here.

https://brainly.com/question/29023210

#SPJ4

Which president implemented the Philadelphia Plan, which required contractors to establish specific goals and timetables for correcting imbalances in employment practices?
President Nixon
President Johnson
President Kennedy
President Franklin D. Roosevelt

Answers

"President Nixon implemented the Philadelphia Plan, which required contractors to establish specific goals and timetables for correcting imbalances in employment practices."

Designed to reply to the virtual exclusion of racial minorities in the industrial & craft unions taking part in federally funded construction projects in the Philadelphia area, the Philadelphia Plan de- manded that govern-ment contractors submit minority employment goals as part of their contract-ing bids.

The plan required federal con-tractors to meet certain goals for the hiring of minor-ity employees by specific dates in order to combat institution-alized discrimination on the part of specific skill-ed building trades unions. The plan was quick-ly extend-ed to ot-her cities.

To know more about the Philadelphia Plan click below:

brainly.com/question/3954684

#SPJ4

Training should be performed in which of these situations?Lack of motivation is cited as the cause of a performance deficit.An increase in performance will justify the training expense.Training is available and inexpensive.The organization's strategic goals include enhancing quality.

Answers

While training can be valuable in a variety of situations, it is most effective when it is specifically targeted to address a performance deficit or to help employees acquire new skills and knowledge that will improve their performance on the job.

"An increase in performance will justify the training expense."

Simply citing a lack of motivation as the cause of poor performance may not necessarily warrant training, as motivation is a complex and multifaceted issue that may require different interventions depending on the specific factors involved. Likewise, the availability and cost of training should not be the sole determinants of whether or not to invest in employee development. Instead, the decision to train should be based on a careful analysis of the expected benefits and costs, including the potential impact on performance, productivity, quality, customer satisfaction, and other key organizational outcomes.

Learn more about “ variety of situations,  “ visit here;

https://brainly.com/question/13175089

#SPJ4

Define race and class and describe how both of these are used tostructure access to opportunity and resources.

Answers

Race refers to a social construct used to categorize people based on physical characteristics such as skin color, hair texture, and facial features.

Class, on the other hand, refers to a socio-economic category that divides people into different social and economic strata based on their income, occupation, education, and wealth.

Both race and class are used to structure access to opportunity and resources in society. Historically, people from certain racial and ethnic groups have been systematically excluded from access to resources and opportunities such as education, employment, housing, and healthcare. For instance, racial segregation in housing and education has limited access to quality education, employment, and housing for many people of color. This has resulted in disparities in income, wealth, and opportunities.

Similarly, class has been used to determine access to resources and opportunities. People from lower socio-economic classes have limited access to quality education, healthcare, and employment opportunities, which can restrict their upward mobility and perpetuate poverty. This can result in a cycle of poverty that is difficult to break.

Learn more about employment here:

https://brainly.com/question/1361941

#SPJ11

ron oort invests in a high risk financial asset to help him achieve his goal of buying a speed boat in five years. this asset is much riskier than his retirement portfolio. this is an example of: multiple choice question.

Answers

This is an example of a non-diversified and aggressive investment strategy. Ron is taking on higher risk in hopes of achieving a specific goal within a short timeframe.

However, it is important to note that this strategy may not be suitable for everyone, especially for those with a long-term retirement portfolio. It is recommended to diversify investments across different asset classes and risk levels to minimize overall risk and maximize returns over the long run. Additionally, it is important to regularly review and adjust one's portfolio based on changing financial goals and market conditions.

To know more about diversification, visit https://brainly.com/question/417234

#SPJ11

Other Questions
Question 2 Given that f(x) = -5+8x (a) Determinef'(x). (b) Determine f(x+h). (c) Hence, determine lim f(x +h)-f(x) h Question 3 (a) Determine the derivative of f(x)= (1+x* 2x) (b) Hence, evaluate f'(1) a serious complication that occurs frequently in the C-spine is acute locking of the facet joints... What is this called? What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily? Which of the following definitions best describes rigor in quantitative research?1. Time frame in which the research takes place2. Degree of aggressiveness used in acquiring the data3. Amount of control and precision exerted by the methodology4. Process used to synthesize findings to form conclusions from a study What profile payload is not available for computers?a) Restrictionsb) Lock Screen Messagec) Maild) Directory Use the given data to find the minimum sample size required to estimate the population proportion.Margin of error: 0.04; confidence level : 99%; from a prior study, p hat is estimated by 0.07. a nonmechanical water meter could u5lize the hall effect by applying a magne5c field across a metal pipe and measuring the hall voltage produced. what is the average fluid velocity in a 3.50- cm-diameter pipe, if a 0.750-t field across it creates a 75.0-mv hall voltage Carter Motor Company claims that its new sedan, the Libra, will average better than 70 miles per gallon in the city. Use , the true average mileage of the Libra. Express the null hypothesis H0 and the alternative hypothesis H1 in symbolic form. What increases as you go deeper into the ocean?A. Pressure, temperature, and densityB. Just pressure and temperatureC. Just densityD. Just temperature and salinity a nurse is caring for a client admitted to the unit for nausea and vomiting who was treated with ondansetron. a friend visiting the client asks the nurse why the client is sleeping. which is the nurse's best response? the scala of the cochlea which houses the actual hearing apparatus Characteristics of human immunodeficiency virus neuropathy include: (Select 2)distal polyneuropathy rapid sudden onset proximal muscle weakness allodynia upper extremities most commonly involved proximal to distal progression of symptoms If cerebral malaria-causing infected erythrocyte in brain venules lost its adhesion to endothelium, it would most likely first flow into which type of blood vessel?a. arteriolesb. veinsc. capillariesd. arteries How can we define entropy using boltzmann's constant? daryl is managing a cross-functional team that often is confined to virtual meetings. he feels like group identity has given way to individual performance measures. what is a practical way that daryl can reorient the team to team goals? THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA? what is the required rate of return on a stock with a beta of 1.9? round your answer to one decimal place. tech a states that a dtc is set if the electrical system of a secondary air injection system fails. tech b states that a check engine light is also illuminated at that instance of component failure. who is correct? solve for particular solution using exponential shift7. (D + 3)'y = 15x2e - 3x 8. (D - 4)'y = 15xe4x 9. DD - 2)2y = 16e2x 10. D'D + 3) y = 9e - 3x 11. (D D 2 y = 18xe" 12. (D? - D - 2)y = 36xe2x Ans.y = 4x'e-3x Ans.y = $x*e** Ans.y = 2x%e2 A hospital ramp for patients is inclined at 25. The height of the ramp is 12 meters. What is the distance a patient will walk on the ramp? Round your answer to the nearest hundredth