pension funds pay lifetime annuities to recipients. if a firm remains in business indefinitely, the pension obligation will resemble a perpetuity. suppose, therefore, that you are managing a pension fund with obligations to make perpetual payments of $2.1 million per year to beneficiaries. the yield to maturity on all bonds is 20%. a. if the duration of 5-year maturity bonds with coupon rates of 16% (paid annually) is 3.7 years and the duration of 20-year maturity bonds with coupon rates of 7% (paid annually) is 6.5 years, how much of each of these coupon bonds (in market value) will you want to hold to both fully fund and immunize your obligation?

Answers

Answer 1

The best allocation to minimize the risk of interest rate changes and fully fund the $10.5 million obligation.

How much money to fully fund and immunize your pension fund's obligation?

To fully fund and immunize your pension fund's obligation, you need to match the duration of the assets in your portfolio to the duration of your liabilities.

Your obligation is a perpetuity, which means it has an infinite duration.

However, since you only have access to 5-year and 20-year maturity bonds, you'll need to find a mix that best matches the duration of your liability.

You also need to calculate the present value of your pension obligation:

PV = annual payment / yield to maturity = $2.1 million / 0.2 = $10.5 million

To determine the proportions of the two bonds you need, you can use the formula:

Obligation Duration = (Proportion of 5-year bond * Duration of 5-year bond) + (Proportion of 20-year bond * Duration of 20-year bond)

Since the obligation duration is infinite, the best approach is to maximize the portfolio duration by allocating more weight to the 20-year bond.

In this case, assume you invest 100% in the 20-year bond with a 7% coupon rate.

The present value of this bond would be:

PV = annual payment / yield to maturity = ($10.5 million * 0.07) / 0.2 = $3.675 million

This investment would result in a duration of 6.5 years, which is the highest possible given the available bonds.

Although this doesn't perfectly match the duration of the pension obligation, it's the best allocation to minimize the risk of interest rate changes and fully fund the $10.5 million obligation.

Learn more about obligations at

https://brainly.com/question/22352906

#SPJ11


Related Questions

The Statute of Frauds does not require that the signature be handwritten; any identification of the party which signifies his or her assent is sufficient. True or false?

Answers

Due to the Statute of Frauds, certain contracts must be in writing in order to be upheld in court. True

This includes contracts for the sale of goods over a certain value, contracts for the transfer of real property, and contracts that cannot be performed within one year. While many people assume that the Statute of Frauds requires a handwritten signature on the written contract, this is not necessarily the case.

Any form of identification that signifies the party's assent to the terms of the contract may be sufficient, such as an electronic signature or a stamp with the party's name. Ultimately, the key is to have a written record that clearly shows the agreement between the parties.

Learn more about certain contracts

https://brainly.com/question/28482648

#SPJ4

a manager is interested in boosting profits on the total sales of multiple products so she runs a lp model and got the following sensitivity analysis table. which of the products does the manager have more flexibility in increasing its profit if she wants to stay at the current optimal solution? product final value reduced cost objective coefficient allowable increase allowable decrease z1 100 0 5 3 0.5 z2 200 0 4 0.5 1 z3 250 0 3 1.5 0.25 z4 400 0 4 1 1.25 group of answer choices z1 z2 z3 z4

Answers

The table provides us with the final value, reduced cost, objective coefficient, allowable increase, allowable decrease, and the optimal solution for each product.

Looking at the table, we can see that all products have a reduced cost of 0, meaning that any increase in the profit of a product will not affect the optimal solution. However, the objective coefficient and allowable increase/decrease values provide insight into which product has more flexibility.

Product Z1 has the highest objective coefficient at 5, meaning that an increase in its profit will have the greatest impact on the total sales profits. Additionally, it has an allowable increase of 3, which is the highest among all the products. This means that the manager has more flexibility in increasing the profit of product Z1 while still staying within the current optimal solution.

Product Z2 also has a high objective coefficient and an allowable increase of 0.5, making it the second-best option for the manager to increase profit while maintaining the optimal solution.

Product Z3 and Z4 have lower objective coefficients and allowable increases/decreases, indicating that the manager has less flexibility in increasing their profits without affecting the optimal solution.

In conclusion, the manager has more flexibility in increasing the profit of product Z1 while staying at the current optimal solution. However, it is important to consider other factors such as production costs and market demand before making any changes to the sales strategy.

For more such questions on product

https://brainly.com/question/25922327

#SPJ11

All of the following are potential advantages of decentralization EXCEPT
a. Frees top managements time
b. Encourages use of export knowledge
c. Potential duplication of costs
d. Provides training

Answers

All of following are "potential-advantages" of "de-centralization" EXCEPT (c) Potential duplication of costs.

Decentralization is defined as the process of delegating decision-making authority and responsibility from a central or top level of an organization to lower-level managers or departments within the organization.

The organization is distributing decision-making power to lower levels, allowing them to make decisions and handle day-to-day operations independently.

This can have potential advantages such as freeing up top management's time, encouraging the use of local or export knowledge, and providing training opportunities for lower-level managers. The potential duplication of cost is considered as a disadvantage.

Therefore, the correct option is (c).

Learn more about Decentralization here

https://brainly.com/question/30387723

#SPJ4

another potential role of central banks is to foster confidence in the banking system by making sure that people can retrieve their money even if a bank goes bankrupt. what is the term for this? deposit guarantee banking promise deposit insurance financially distressed institution clause

Answers

In the event that a bank or other financial institution goes bankrupt or is unable to fulfil its responsibilities, depositors are guaranteed a set amount of money under a system known as deposit insurance by the government.

What is depositors?

Customers of a financial institution who have funds on deposit are known as depositors. The money deposited can be in the form of cash, securities, or other assets, and the depositors can be people, companies, or other organisations. Depositors typically receive some kind of protection from the financial institution they are transacting with.

This can include protections offered by other governmental organisations, the stability of the financial institution itself, or insurance on US deposits provided by the Federal Deposit Insurance Corporation (FDIC). Depositors are reassured that their money is safe even in the event of a bank failure, which promotes confidence in the banking system.

To learn more about depositors

brainly.com/question/27378060

#SPJ1

What should be the role of ASEAN in Regards to Super Power's Conflict (Between US, China and Japan) in the Region?

Answers

The Association of Southeast Asian Nations (ASEAN) plays a crucial role in managing and resolving conflicts between superpowers like the United States, China, and Japan in the region.

ASEAN has been instrumental in promoting regional cooperation, economic integration, and diplomatic dialogue among its member states, which includes Brunei Darussalam, Cambodia, Indonesia, Laos, Malaysia, Myanmar, the Philippines, Singapore, Thailand, and Vietnam.

In the context of the superpowers' conflict in the region, ASEAN's role should be to promote peace, stability, and mutual cooperation among its member states and with external powers. ASEAN should encourage all parties to abide by international laws and norms, such as the United Nations Convention on the Law of the Sea (UNCLOS), and to resolve disputes through peaceful means, including negotiation and mediation.

ASEAN should also work towards building trust and confidence among all parties, by promoting people-to-people exchanges, cultural diplomacy, and economic cooperation. It should encourage the superpowers to pursue constructive engagement and dialogue, and to avoid any actions that may escalate tensions or lead to military conflict.

Learn more about military conflict here:

https://brainly.com/question/20715477

#SPJ11

walmart has made significant progress towards achieving its goal of zero waste. why does this particular goal seem to fit walmart's culture better than renewable energy goals and greener products?\

Answers

Walmart's goal of achieving zero waste seems to fit the company's culture better than renewable energy goals and greener products for several reasons:

Cost Savings: Walmart is known for its focus on low prices and cost savings, and reducing waste can help the company save money by minimizing landfill fees, reducing disposal costs, and optimizing resource utilization. Achieving zero waste aligns with Walmart's business model and can help the company achieve its cost-saving goals.Operational Efficiency: Walmart is known for its highly efficient supply chain and logistics operations, and reducing waste fits into this focus on operational efficiency. By optimizing waste reduction and recycling programs, Walmart can improve its operational efficiency and reduce costs.Brand Image: Walmart is also highly focused on its brand image and reputation, and reducing waste aligns with the company's sustainability goals and social responsibility initiatives. Achieving zero waste can improve Walmart's brand image and reputation, which is important to the company's long-term success.Cultural Fit: Walmart's culture is highly focused on continuous improvement and achieving results. The goal of zero waste aligns with this culture by providing a clear and measurable target for the company to work towards. In contrast, renewable energy goals and greener products may be viewed as more ambiguous or difficult to measure, which may not fit as well with Walmart's culture.

Learn more about “ Brand Image “ visit here;

https://brainly.com/question/30468005

#SPJ4

Korean government decides to reduce air pollution by discouraging the country’s reliance on gasoline use. They will impose a 500 KRW (won, Korean currency unit) tax on each liter of gasoline sold. The government expects this policy will be very effective in cutting the gasoline consumption (they care less about tax revenue from the new policy), particularly in the short run than in the long run. True or false? Why? Explain with a demand-supply diagram.

Answers

True, the Korean government's policy of imposing a 500 KRW tax on each liter of gasoline sold is likely to be very effective in cutting gasoline consumption, particularly in the short run.

Here's how it can be explained with a demand-supply diagram:

In the short run, the demand for gasoline tends to be inelastic, meaning that a change in price has a relatively small effect on the quantity demanded. This is because people have limited short-run alternatives to gasoline as a means of transportation, so they will continue to purchase gasoline even if the price increases. Therefore, the demand curve for gasoline in the short run is relatively steep.

On the other hand, the supply of gasoline is relatively inelastic in both the short run and the long run. This is because it takes time and investment to develop and bring new sources of energy to the market, such as electric or hybrid vehicles. Therefore, the supply curve for gasoline is relatively steep in both the short and long run.

Learn more about Korean government' here:

https://brainly.com/question/12856245

#SPJ11

Frank's sole proprietorship reports $100,000 of net profit on his 2019 Schedule C. If Frank has no other earned income, what is his 2019 deduction for self-employment tax?
A) $7,650
B) $14,130
C) $7,065
D) $15,300

Answers

His 2019 deduction for self-employment tax is $15,300. Therefore the answer is D) $15,300.

Tax is a financial charge imposed by a government or other authority on income, goods, services, or activities. It is a mandatory payment that individuals, businesses, and other entities must make to the government, typically based on their income, property, or other factors that are subject to taxation. The deduction for self-employment tax is calculated by multiplying the net profit from the Schedule C by the self-employment tax rate. The self-employment tax rate for 2019 is 15.3%, which is made up of 12.4% for Social Security and 2.9% for Medicare.

Therefore, the deduction for self-employment tax for Frank in 2019 would be:

$100,000 x 0.153 = $15,300

Answer: D) $15,300

You can learn more about The tax in this link: https://brainly.com/question/16423331

#SPJ11

the software development work package starts on march 1st and will end during september of the same year. what earned value technique would not be advisable for this work package

Answers

0/100 rule may not be advisable for your software development work package due to its inability to reflect incremental progress, which is common in such projects. Instead, consider using other earned value techniques such as the 50/50 would be much better  



The 0/100 rule is an earned value technique that assigns 0% of the budgeted cost for a work package until it is fully completed, and then assigns 100% of the budgeted cost once the task is finished. This approach can be problematic for software development projects, as it does not reflect the incremental progress that often occurs throughout the project's duration.



Software development tasks are typically iterative and can involve continuous adjustments and improvements. Consequently, this method may not accurately represent the actual progress made, leading to potential issues in project monitoring, control, and decision-making. The 0/100 rule can cause sudden and misleading spikes in performance data, making it difficult for project managers to track real progress and implement timely corrective actions.

Know more about decision-making here:

https://brainly.com/question/31422716

#SPJ11

Use the AS/AD model to show what will happen to the economy if the Fed were to raise its target rate. Assume that the economy begins in the intermediate region of the AS curve. Comment on what happens to GDP, the price level, and employment.

Answers

If the Fed raises its target rate, the economy may experience a decrease in GDP, a lower price level, and reduced employment levels according to the AS/AD model.

Using the AS/AD model, if the Federal Reserve (Fed) raises its target interest rate, it will have the following effects on the economy, assuming it begins in the intermediate region of the Aggregate Supply (AS) curve:

1. GDP: When the Fed raises the target rate, borrowing becomes more expensive, leading to a decrease in investment and consumer spending. This causes a reduction in Aggregate Demand (AD). In the AS/AD model, the AD curve shifts to the left, leading to a lower equilibrium GDP.

2. Price Level: With the decrease in AD, the equilibrium point in the AS/AD model moves down along the intermediate region of the AS curve, which indicates a lower price level.

3. Employment: As GDP decreases, businesses may experience reduced demand for their products and services, leading them to cut back on production. This reduction in production may result in lower employment levels, as companies lay off workers or reduce hiring.

Learn more about GDP here:-

https://brainly.com/question/31076716

#SPJ11

paradiso medical clinic measures its activity in terms of patient-visits. last month, the budgeted level of activity was 1,060 patient-visits and the actual level of activity was 1,050 patient-visits. the cost formula for administrative expenses is $3.00 per patient-visit plus $17,000 per month. the actual administrative expense was $19,300. in the clinic's performance report for last month, the spending variance for administrative expenses was:

Answers

Therefore, the spending variance for administrative expenses for last month was $17,968.80. This means that the clinic spent $17,968.80 more than what was budgeted for administrative expenses based on the actual level of activity.

Budgeted administrative expenses = (Budgeted patient-visits x Cost per patient-visit) + Fixed administrative expenses
Budgeted administrative expenses = (1,060 x $3.00) + $17,000
Budgeted administrative expenses = $20,780
Actual cost per patient-visit = Actual administrative expenses / Actual patient-visits
Actual cost per patient-visit = $19,300 / 1,050
Actual cost per patient-visit = $18.38

Actual administrative expenses = (Budgeted patient-visits x Actual cost per patient-visit) + Fixed administrative expenses
Actual administrative expenses = (1,060 x $18.38) + $17,000
Actual administrative expenses = $38,748.80
Spending variance = Actual administrative expenses - Budgeted administrative expenses
Spending variance = $38,748.80 - $20,780
Spending variance = $17,968.80
The spending variance could be attributed to various factors such as unexpected increase in the cost of supplies or higher salaries for administrative staff. The clinic should analyze the spending variance and take corrective actions to control costs in the future.

For more such questions on expenses

https://brainly.com/question/29844123

#SPJ11

What is a monetary union? Discuss the advantages and drawbacksin forming such an arrangement.

Answers

A monetary union can bring advantages and disadvantages to member countries, and careful consideration should be given to the costs and benefits of such an arrangement before joining.

A monetary union is an agreement between two or more countries to share a common currency and a unified monetary policy. This means that member countries give up their own currencies and adopt a single currency for their economies. The most prominent example of a monetary union is the Eurozone, which consists of 19 European countries that share the euro as their common currency.

Advantages of a monetary union include:

1. Elimination of currency exchange costs and risks: Member countries can trade with each other without incurring currency exchange costs and risks, which can increase economic efficiency and promote trade.

2. Increased economic stability: A unified monetary policy can help stabilize exchange rates, interest rates, and inflation rates across member countries.

3. Greater price transparency: A common currency can make it easier for consumers and businesses to compare prices across member countries, which can lead to more competition and lower prices.

Drawbacks of a monetary union include:

1. Loss of national sovereignty: Member countries give up control over their monetary policy, which can limit their ability to respond to economic shocks and downturns.

2. Lack of flexibility: A unified monetary policy may not be appropriate for all member countries, as each country may have different economic conditions and priorities.

3. Unequal distribution of benefits and costs: Some member countries may benefit more than others from a monetary union, and some may incur more costs, depending on their economic conditions and competitiveness.

In conclusion, a monetary union can bring advantages and disadvantages to member countries, and careful consideration should be given to the costs and benefits of such an arrangement before joining.
A monetary union is an economic arrangement where multiple countries adopt a single currency and coordinate their monetary policies through a centralized authority, such as a central bank. The primary advantages of forming a monetary union include increased economic integration, trade facilitation, and reduced transaction costs. However, the drawbacks involve the loss of individual monetary policy control and potential economic disparities between member countries.

Learn more about monetary union here:-

https://brainly.com/question/28146506

#SPJ11

When a producer of joint goods refuses to sell all of one good, the producer: must destroy some of the low-demand good

Answers

When a producer of joint goods refuses to sell all of one good, the producer may need to destroy some of the low-demand good or find alternative ways to utilize or dispose of it. This is because joint goods are often produced simultaneously, and disposing of the less popular good can be necessary to maintain market balance and profitability.

When a producer of joint goods refuses to sell all of one good, the producer may have to allocate the goods among the buyers. This could result in the producer having excess inventory of the low-demand good that they are unable to sell. In this case, the producer may have to choose to either reduce the price of the low-demand good to increase its demand or potentially destroy some of the excess inventory in order to free up storage space and avoid losses from storing unsold goods.

Learn more about profitability here:-

https://brainly.com/question/15036999

#SPJ11

jen industries had sales of $32 million this year and an average accounts receivable of $0.8 million per day. on average, how long does it take to collect on its sales?

Answers

To determine how long it takes Jen Industries to collect on its sales, we need to calculate the average accounts receivable turnover, which is the number of times per year that the company collects its average accounts receivable balance.

To do this, we first need to calculate the average accounts receivable balance: Average accounts receivable = (0.8 million per day) x (365 days per year) = $292 million Next, we can calculate the accounts receivable turnover:
Accounts receivable turnover = Sales / Average accounts receivable Accounts receivable turnover = $32 million / $292 million = 0.1096

Finally, to determine how long it takes to collect on its sales, we can divide the number of days in a year by the accounts receivable turnover: Days to collect on sales = 365 / Accounts receivable turnover
Days to collect on sales = 365 / 0.1096 = 3,330.58. Therefore, on average, it takes Jen Industries approximately 3,331 days (or just over 9 years) to collect on its sales.
Read more about Industries here:https://brainly.com/question/1082619
#SPJ11

For economists, substitutes for laboratory experiments often come in the form of

Answers

For economists, substitutes for laboratory experiments often come in the form of natural experiments, field experiments, and quasi-experiments.

What are the significance of these experiments?

A natural experiment is a situation where the assignment of subjects to groups is determined by factors outside of the researcher's control, such as policy changes, weather conditions, or natural disasters.

For example, the minimum wage increase in a particular state can be considered a natural experiment, where the effects of the policy change can be observed by comparing the outcomes of the affected and non-affected groups.

A field experiment is a study conducted in a real-world setting, where the researcher manipulates one or more variables and observes their effects on the subjects.

For example, a researcher may conduct a field experiment to test the effectiveness of a new advertising campaign by randomly assigning different groups of consumers to different versions of the campaign.

A quasi-experiment is a study where the assignment of subjects to groups is based on some criteria or variable, but the researcher does not have full control over the assignment process.

For example, a study comparing the outcomes of patients who received a new drug to those who did not, where the assignment to the treatment and control groups is based on the patients' medical condition and the availability of the drug, can be considered a quasi-experiment.

To know more about natural experiments visit:

https://brainly.com/question/5001950

#SPJ11

the economic law which to states savings and production must occur before consumption is called that the rooseveltadministrationtried bypass with its economic policies is called?

Answers

The economic law that states savings and production must occur before consumption is called the "Say's Law," also known as "Say's Law of Markets."

Say's Law is named after the French economist Jean-Baptiste Say, who first proposed it in the early 19th century. According to Say's Law, the production of goods and services generates income, which in turn creates demand for those goods and services.

In other words, supply creates its own demand. Say argued that in a well-functioning market economy, the act of producing goods and services creates income for producers, which they can then use to consume or save.

This view suggests that production and savings are necessary prerequisites for consumption and economic growth. It's worth noting that Say's Law has been subject to debate among economists, and its applicability in different economic contexts has been a topic of discussion.

to know more about economic law refer here

https://brainly.com/question/8054169#

#SPJ11

What is a fundamental assumption to the Bertrand Model?

Answers

The Bertrand model is an economic model that assumes perfect competition between firms in a market. One of the fundamental assumptions of the Bertrand model is that firms compete on price, rather than product differentiation or other factors.

In the Bertrand model, each firm assumes that its competitor will maintain its current market share and sets its price accordingly. If a firm sets its price higher than its competitor, it will lose market share and will be forced to lower its price. Conversely, if a firm sets its price lower than its competitor, it will gain market share and may be able to maintain its price.

This assumption is based on the idea that consumers are rational and will always choose the product with the lowest price, all other things being equal. Therefore, firms in the Bertrand model engage in a price war, with each firm trying to undercut the other to gain market share. This assumption leads to the conclusion that in a Bertrand duopoly, prices will be driven down to marginal cost, which is the minimum price at which a firm can produce and sell its product and still cover its costs.

Overall, the fundamental assumption of the Bertrand model is that firms set prices strategically, taking into account the prices set by their competitors. This assumption leads to the conclusion that in a Bertrand duopoly, prices will be driven down to marginal cost, resulting in lower profits for both firms.

Learn more about Bertrand model: https://brainly.com/question/31530620

#SPJ11

13. The following is the balance sheet of a banking system.
Assets Liabilities Reserves $1,000 Deposits $4,000 Loans $3,000
Assume the required reserve ratio is 20% and there is no cash leakage.
(a) Calculate the amount of excess reserves held by banks.
(b) Calculate the increase in the amount of loans after lending out the excess reserves.(3 marks)

Answers

The excess reserves held by the banks are $200, and the increase in the amount of loans after lending out the excess reserves is $1,000.

(a) The required reserve ratio is 20%, which means that banks must hold 20% of deposits as reserves. In this case, total deposits are $4,000, so banks must hold $800 (20% of $4,000) in reserves. However, they are holding $1,000 in reserves, which means they have excess reserves of $200.

(b) Banks can lend out their excess reserves, which will increase the amount of loans they hold. The maximum increase in loans is determined by the money multiplier, which is the inverse of the reserve ratio. In this case, the reserve ratio is 20%, so the money multiplier is 1/0.2 = 5.

The amount of loans that can be created by the excess reserves is:

Excess reserves x money multiplier = $200 x 5 = $1,000

Therefore, the increase in the amount of loans after lending out the excess reserves is $1,000.

Learn more about deposits here:

https://brainly.com/question/22697743

#SPJ11

What does Holden mean when he writes that stradlater "was a little bit like ackley"? In what way or ways are these two different or similar? Is Ackley or stradlater like Holden?

Answers

Answer:

Holden Caulfield, Stradlater, and Ackley are all characters in J.D. Salinger’s novel “The Catcher in the Rye.” Stradlater is Holden’s roommate at Pencey Prep, while Ackley is a student who lives in the adjoining room. Holden finds Ackley annoying and repulsive due to his terrible personal hygiene and lack of popularity. On the other hand, Stradlater is popular and handsome but Holden thinks he is a “phony” and is displeased that Stradlater’s date is Jane Gallagher.

When Holden writes that Stradlater “was a little bit like Ackley,” he may be referring to some similarities between the two characters. For example, both Stradlater and Ackley can be emotionally distant and uncommunicative. However, there are also many differences between the two characters. Stradlater is popular and well-liked while Ackley is not.

As for whether Ackley or Stradlater is like Holden, there are hints that Holden views Ackley as a version of himself. However, Holden also has some similarities with Stradlater. For example, both characters can be emotionally distant and uncommunicative.

Explanation:

porter's 5-forces was discussed in my ppt slides, applying the 5 part model to missouri state university, we have a number of competitive threats including several 4 year institutions which are rivals. currently a unique competitive threat (technically a substitute but acts more like a rival) is:

Answers

Without further information, it is difficult to determine the unique competitive threat acting as a substitute but acting more like a rival to Missouri State University. However, based on Porter's Five Forces model, some potential substitutes that could pose a competitive threat to the university could include:

1. Online learning platforms:

As online education becomes increasingly popular, students may opt to take classes online from other universities or online learning platforms, rather than attending Missouri State University.

2. Community colleges:

Community colleges can offer affordable education options for students looking to obtain a degree or take classes without incurring large amounts of debt. Students may choose to attend community college first before transferring to Missouri State University, or they may opt to complete their degree at a community college rather than attending a four-year institution.

3. Vocational schools:

For students who are interested in pursuing vocational or technical careers, vocational schools can offer specialized training and education that Missouri State University may not provide. This could be a potential substitute for students who are not interested in pursuing a traditional four-year degree.

4. Alternative forms of education:

Alternative forms of education, such as apprenticeships or online certification programs, can provide students with the skills and knowledge necessary for their desired careers without attending a traditional university.

It's important to note that these potential substitutes may not necessarily be unique to Missouri State University and may be threats to other universities as well. The key to maintaining competitiveness in the face of these threats is for Missouri State University to identify and leverage its unique strengths and competitive advantages.

To know more about Missouri State University refer here

https://brainly.com/question/30399161#

#SPJ11

TRUE/FALSE.The EOQ model is best suited for items whose demand is dependent on other products.

Answers

False. Items whose demand is based on other products are best suited for the EOQ model.

Why is the EOQ model employed?

Economic order quantity is a measure that depicts the appropriate order amount to keep expenses down for the company. Businesses of all sizes and types that order and retain inventory can benefit from using the economic order quantity formula.

Which of the following claims regarding the EOQ model is accurate?

All of the aforementioned claims are true. As Ordering Cost is truly present on top, if it were to gradually double, the Economic Order Quantity would eventually rise. The Economic Order Quantity would then increase if the Yearly Demand eventually doubled.

To Know more about  retain inventory

https://brainly.com/question/28545612

#SPJ1

T/F? Growth companies are those firms that consistently earn higher rates of return by assuming greater amounts of risk.

Answers

The given statement “Growth companies are those firms that consistently earn higher rates of return by assuming greater amounts of risk” is  false. because Growth companies are firms that are expected to grow their earnings at an above-average rate compared to the overall market.

These companies typically reinvest their earnings into expanding their business, developing new products, entering new markets, or making acquisitions to support their growth objectives.

While growth companies may assume some level of risk in pursuit of higher growth, it is not accurate to say that they consistently earn higher rates of return by assuming greater amounts of risk.

It's important to note that risk and return are related concepts in finance. Generally, higher returns are expected to come with higher levels of risk, as investors require compensation for taking on additional risk.

Therefore, it would be incorrect to make a blanket statement that growth companies consistently earn higher rates of return by assuming greater amounts of risk without considering the specific circumstances of each company and its risk-return profile.

To know more about Growth Companies refer here:-

https://brainly.com/question/12609944#

#SPJ11

in the absence of network effects, the value of a product or service increases as the number of users grows. group of answer choices true false

Answers

The statement that "in the absence of network effects, the value of a product or service increases as the number of users grows" is false.

Network effects refer to the phenomenon where the value of a product or service increases as more users join the network or use the product. This is because the product becomes more useful, and in some cases, indispensable, as more users adopt it.

For instance, the value of a social media platform or a messaging app increases as more people join since there are more connections and interactions to be made.

Without network effects, the value of a product or service typically relies on its inherent features, quality, and benefits, rather than the number of users. The value of a product or service may not increase as the number of users grows, and it may even decrease if there is a strain on resources or a decrease in quality due to increased demand.

To know more about network effects refer here:

https://brainly.com/question/31442051#

#SPJ11

A company has a dividend payout ratio of 35 percent. If the company's return on equity is 15 percent, what is the expected growth rate if no new outside financing is used?a. 4.50%b. 5.25%c. 7.75%d. 8.25%e. 9.75%

Answers

A company has a dividend payout ratio of 35 percent expected growth rate is defined in this policy as having met the requirement that students perform, on average, as well in their current grade. The correct answer is e 9.75%.

Content as was typical for the same student in previous grades or contents when using the change scale to compare and allowing for a factor of regression to the mean.

To calculate growth rates, divide the difference between the starting and ending values for the period under study by the starting value. A dividend investor would regard a range of 35% to 55% to be healthy and appropriate. If a corporation is anticipated to release around half of its earnings as dividends, it is well-established and a leader in its sector.

ROE =15% = 0.15

Pay out Ratio = 35%.= 0.35

Growth= ROE x (1 - payout ratio).

=15 (1-0.35) = 0.0975 = 9.75 %

To know more about growth rate visit:

https://brainly.com/question/28961964

#SPJ4

in what state did donald trump file his state tax returns while he was in office as president between 2017 and 2021?

Answers

Donald Trump served as the 45th President of the United States from 2017 to 2021. During this time, he filed his state tax returns in the state of New York. This change was primarily for tax-related reasons, as Florida has more favorable tax laws compared to New York.

Nevertheless, for the majority of his time in office, Trump filed his state tax returns in New York.

Trump has had long-standing connections to New York, with his business headquarters and primary residence located in the Trump Tower in Manhattan. However, in late 2019, he announced that he would be changing his primary residence to Florida, specifically to his Mar-a-Lago estate in Palm Beach.

This change was primarily for tax-related reasons, as Florida has more favorable tax laws compared to New York. Nevertheless, for the majority of his time in office, Trump filed his state tax returns in New York.

to learn more about tax returns

https://brainly.com/question/26316390

#SPJ11

Suppose the equilibrium wage is $10 per hour. An effective/binding___ would be set at____. (1 Point) O price floor, $12 per hour O price floor, 58 per hour O price ceiling: $10 per hour O price ceiling: $12 per hour

Answers

An effective/binding price ceiling would be set at $10 per hour if the equilibrium wage is $10 per hour.

A price ceiling is a government-imposed limit on the price that can be charged for a good or service. It is typically set below the market equilibrium price, with the intention of making the good or service more affordable to consumers, especially those with low incomes. Price ceilings are most commonly used for basic necessities such as housing, utilities, and food. For example, rent control is a form of price ceiling that limits the amount a landlord can charge for rent on a property. While price ceilings may make goods and services more affordable for consumers, they can also create shortages and reduce the quality of the goods and services available. When the price ceiling is set below the market equilibrium price, there is excess demand for the good or service, which can lead to long waiting lists, rationing, and a black market. In addition, suppliers may reduce the quality of the goods or services they offer, since they cannot raise prices to cover the cost of producing high-quality products.

learn more about price ceiling here:

https://brainly.com/question/30797941

#SPJ11

at the end of a project, the equipment purchased at the beginning is expected to have a positive market value that is greater than the book value. how should the salvage value affect terminal cash flows? group of answer choices use the book value use the expected market value less the taxes incurred on the difference between the salvage value and the book value use the difference between the expected market value and the book value use the expected market value

Answers

The salvage value should be based on the expected market value at the end of the project.

This value should be used to calculate the terminal cash flows. It is important to note that any taxes incurred on the difference between the salvage value and the book value should also be taken into account when calculating the expected market value.

Therefore, the correct answer would be to use the expected market value less the taxes incurred on the difference between the salvage value and the book value.

To know more about salvagevalue  click on below link :

https://brainly.com/question/28387066#

#SPJ11

If a company is pursuing a strategy to produce branded footwear at a low total production cost relative to rival companies, then it should regularly review the production cost benchmarking data on p. 6 of each issue of the Footwear Industry Report to determine whether it should close down whichever production facility that has the highest total production costs per branded pair the benchmarking data on p. 7 of the FIR to determine whether it has achieved the lowest possible total branded costs per pair sold in each geographic region. the production cost benchmarking data on p. 6 of each issue of the Footwear Industry Report to see if its efforts to achieve low total production costs per branded pair have been more/less successful than other companies pursuing much the same outcome. the production cost benchmarking data on p. 6 of each issue of the Footwear Industry Report 8 to help determine whether it should make maximum use of overtime at each of the company's production facilities to help lower total production costs per pair. o page 4 of the FIR to help determine whether to (1) invest in one or more production improvement options, (2) bid more aggressively to win private-label contracts to help lower total production costs, or (3) sell some of the new or refurbished equipment at one or more production facilities. 0

Answers

If a company is pursuing a strategy to produce branded footwear at a low total production cost relative to rival companies, then it should regularly review the production cost benchmarking data on p. 6 of each issue of the Footwear Industry Report to determine whether it has achieved the lowest possible total branded costs per pair sold in each geographic region.

This will help the company to identify areas where it can further reduce production costs and improve its competitiveness in the market. By comparing its production costs with those of its rivals, the company can determine whether its efforts to achieve low total production costs per branded pair have been more or less successful than other companies pursuing the same goal.

By focusing on reducing production costs per pair sold, the company can improve its profit margins and better compete on price with other companies in the market. It may also be able to offer its branded footwear at a lower price point than its competitors, which can help to attract more customers and increase market share.

To know more about  supply  here

https://brainly.com/question/1222851

#SPJ4

when general electric won a contract for a $150 million generator project in romania, it agreed to take payment in the form of romanian goods that could be sold for $150 million on international markets. this is an example of

Answers

The situation described is an example of barter trade, which involves the exchange of goods or services for other goods or services, without the use of money.

In this case, General Electric agreed to take payment for the generator project in the form of Romanian goods, rather than cash. This allowed Romania to pay for the project using goods that it produced, rather than using foreign currency, which could have been more difficult or expensive to obtain. General Electric, in turn, would be able to sell these goods on international markets, generating revenue that could be used to offset the cost of the project.The agreement between General Electric and Romania is an example of barter trade, where goods or services are exchanged directly without using money as a medium of exchange. In this case, General Electric agreed to accept payment for their work in the form of Romanian goods that they could sell in international markets for an amount equivalent to the value of the contract. Barter trade is often used when currency is not readily available or when parties involved do not have confidence in the value of the currency. It can also be used as a means of avoiding currency exchange fees or as a way to offset trade imbalances.

Learn more about payment here:https://brainly.com/question/15136793

#SPJ11

what is the lowest price at which a firm produces an output? explain why. the lowest price at which a firm will produce is the price at minimum because at this price its loss equals . select an answer and submit. for keyboard navigation, use the up/down arrow keys to select an answer. a average total cost; zero b average fixed cost; total variable cost c total cost; zero d average variable cost; total fixed cost

Answers

The lowest price at which a firm will produce an output is the price at minimum average variable cost (AVC) because at this price, its loss equals total fixed cost (TFC). So the correct answer is option d).


A firm produces goods with the purpose of maximizing profit or minimizing loss. When deciding whether to produce, a firm considers its costs, which are divided into fixed costs and variable costs. Fixed costs are expenses that do not change with the level of production, such as rent or machinery. Variable costs, on the other hand, vary depending on the level of production, such as labor or raw materials.


In the short run, the firm has to cover its variable costs to continue production. If the price of a product is lower than the average variable cost, the firm will not be able to cover its variable costs, resulting in even greater losses than by just incurring the fixed costs. Therefore, the firm will stop production and minimize its losses by only incurring fixed costs.


At the minimum average variable cost, the firm's loss equals its total fixed cost, and it can cover all its variable costs. In this situation, the firm will continue to produce since it can minimize its losses by covering the variable costs and contributing towards the fixed costs. Thus, the lowest price at which a firm will produce an output is the price at minimum average variable cost because at this price, its loss equals total fixed cost.

Know more about average variable cost here:

https://brainly.com/question/29306232

#SPJ11

Other Questions
which is the most appropriate response when a client asks if the nurse thinks the ordered nonstress test is necessary? hesi The sketch shows the curve y=x2 + 3x and the tangent at P(2, 10). Find the coordinates of Q. y=x"; p(2,10) 1.Should a competitive firm remain open in the short -run if it is not making a profit, but is able to cover its average variable costs?A. If the firm is not making a profit, it should shut-down.B. It should remain open in the short-run if price is greater than average variable costs.C. It should close, even if it is able to cover its average variable costs.D. It should close if it cannot cover all of its total cos2.A perfectly competitive firm will make a an economic profit at the point where MR = MC if the price that a firm charges is higher than its average cost of production for that quantity produced. true false3.the demand curve for a perfectly competitive firm's products is____________A. Perfectly ElasticB. Perfectly InelasticC. Unitary ElasticD. Unknown4.Marginal revenue is equal to price in monopolistic industries. true false5.A small farm normally is part of this type of market.A. Perfect CompetitionB. OligopolyC. Monopoly Question 2 Given that f(x) = -5+8x (a) Determinef'(x). (b) Determine f(x+h). (c) Hence, determine lim f(x +h)-f(x) h Question 3 (a) Determine the derivative of f(x)= (1+x* 2x) (b) Hence, evaluate f'(1) a serious complication that occurs frequently in the C-spine is acute locking of the facet joints... What is this called? What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily? Which of the following definitions best describes rigor in quantitative research?1. Time frame in which the research takes place2. Degree of aggressiveness used in acquiring the data3. Amount of control and precision exerted by the methodology4. Process used to synthesize findings to form conclusions from a study What profile payload is not available for computers?a) Restrictionsb) Lock Screen Messagec) Maild) Directory Use the given data to find the minimum sample size required to estimate the population proportion.Margin of error: 0.04; confidence level : 99%; from a prior study, p hat is estimated by 0.07. a nonmechanical water meter could u5lize the hall effect by applying a magne5c field across a metal pipe and measuring the hall voltage produced. what is the average fluid velocity in a 3.50- cm-diameter pipe, if a 0.750-t field across it creates a 75.0-mv hall voltage Carter Motor Company claims that its new sedan, the Libra, will average better than 70 miles per gallon in the city. Use , the true average mileage of the Libra. Express the null hypothesis H0 and the alternative hypothesis H1 in symbolic form. What increases as you go deeper into the ocean?A. Pressure, temperature, and densityB. Just pressure and temperatureC. Just densityD. Just temperature and salinity a nurse is caring for a client admitted to the unit for nausea and vomiting who was treated with ondansetron. a friend visiting the client asks the nurse why the client is sleeping. which is the nurse's best response? the scala of the cochlea which houses the actual hearing apparatus Characteristics of human immunodeficiency virus neuropathy include: (Select 2)distal polyneuropathy rapid sudden onset proximal muscle weakness allodynia upper extremities most commonly involved proximal to distal progression of symptoms If cerebral malaria-causing infected erythrocyte in brain venules lost its adhesion to endothelium, it would most likely first flow into which type of blood vessel?a. arteriolesb. veinsc. capillariesd. arteries How can we define entropy using boltzmann's constant? daryl is managing a cross-functional team that often is confined to virtual meetings. he feels like group identity has given way to individual performance measures. what is a practical way that daryl can reorient the team to team goals? THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA? what is the required rate of return on a stock with a beta of 1.9? round your answer to one decimal place.