⭐️ I NEED HELP ASAP: Sam and Joe are brothers. Joe is five less than three times the age of Sam. If the product of their ages is 28, how old are Joe and Sam?

Please explain how you solved it too! Thank you!

Answers

Answer 1

Answer:

joe=6

Sam=11

Step-by-step explanation:

lets see...

i explain 1by1

firstly we know that joe is 5 - 3 x Sam

(read the sentences VERY CAREFULLY)

then, we put Sam as math variable "s"

it will be; 5-3 x S

[tex]5 - 3 \times s[/tex]

the total of their age is 28

[tex]5 - 3 \times s = 28[/tex]

simplify it

it will be 5-S3=28

then you will get 11 right

that will be sam's age

-5 and it will be Joe's age


Related Questions

Which is the graph of f(x) = 1/4 (4)^X?​

Answers

Answer:

Not sure, but it should look like the graph below!

Step-by-step explanation:

Graph using a few selected points.

Horizontal Asymptote:  y = 0

Answer:

Basically D from the other guy's answer.

E2021  1/06/2021

please help me with this.

Answers

Your answer is B it’s x=55

The scale of a map is 1 cm : 7 miles find each distance.
A road is 4 cm long on the map. find the actual length of the road.

Answers

pretty sure the answer is 28 miles

simplify the expression: -3(x+6)

Answers

Answer:

-3x-18

Step-by-step explanation:

The expression -3(x+6) means that -3 is multiplied with x and 6 in the brackets so the answer would be

[tex]-3x-18[/tex]

Answer:

simplificationsimplification-3(X+6)simplification-3(X+6)= -3x- 18

Find measure angle 1

Answers

Answer:

60°

Step-by-step explanation:

Opposite interior angles are equal.

The table shows the results of a survey of students. The survey asked the students whether they have a job and whether they have a car.
Job No Job Total
Car
38
22
60
No Car 16
18
34
Total
54
40
94
What percentage of the students in the survey have a car?
O A 22%
O B. 38%
OC. 40%
OD. 60%
dhe
O E 64%

Answers

Answer:

It’s E. 64%

Step-by-step explanation:

Based on the number of people who had a car and the total number of people surveyed, the percentage is E. 64%

Percentage of those with cars

The percentage of students with a car is:

= Number of students with cars / Number of students in total x 100%

Solving gives:

= 60 / 94 x 100%

= 63.8%

= 64%

In conclusion, option E is correct.

Find out more on percentages at https://brainly.com/question/16193777.

A box of chocolates contained 8% caramels. There were 4 caramels in the box. How many pieces of chocolate are in the box?​

Answers

Answer:

Step-by-step explanation:

If you are desperate, copy and paste the below answer. It should be correct but I don't know your syllabus.

8% C = 4      1% C = 4 ÷ 8 =0.5      100% C = 0.5 × 100 = 50

Hope this helps.


The classroom has 10 desks with boys and
girls. Show one combination of boys and
girls

Answers

Answer:

one combination could be 6 girls and 4 boys

x+2=6x-18

WHAT NUMBER IS X

Answers

Answer:

x=4

Step-by-step explanation:

hope this helps!

Answer: x=4




Explanation

Hallar el máximo común divisor de 20, 70, y 50.

Answers

Answer:

10

Step-by-step explanation:

I have a square garden that has an area of 324. What is length of one side?​

Answers

Answer:

81

Step-by-step explanation:

The shape is a square so it has all equal sides.

324/4=81

Please help me find the answer! Please explain how you got it!

Answers

Answer:

B. 4.5c + 4 = 24

Step-by-step explanation:

T = cx + py  is the equation you are given.

T = 24 because it is the total amount of money you can spend.

x = 4.5 because each phone case costs 4.50 dollars

p = 2 because you bought 2 pop sockets.

y = 2 because each pop socket costs 2 dollars.

There is no c because you don't know the number of phone cases you bought.

Now, we have to substitute the values into the equation:

24 = 4.5x + 2(2)

24 = 4.5x + 4

4.5x + 4 = 24       <--- This is your answer

Hope this helps!

hi please can you answerrr
2x² + x + 15 = 0

Answers

Answer:

x=(-1+i√119)/4

AND

x=(-1-i√119)/4

Step-by-step explanation:

[tex]2x^{2} +x+15=0[/tex]

step1: identify a,b and c from the equation.

a=2

b=1

c=15

step2: use the quadratic formula.

[tex]x=\frac{-b+or- √b^{2}-4ac }{2a}[/tex]

(sub a,b and c)

[tex]x=\frac{-1+or- √1^{2}-4*2*15 }{2*2}[/tex]

(simplify)

[tex]x=\frac{-1+or-√-119}{4}[/tex]

(write the two possible answers)

[tex]x=-\frac{1+i√119}{4}[/tex]  

AND

[tex]x=-\frac{1-i√119}{4}[/tex]


Jordan has a garden that is enclosed by a rectangular fence. The perimeter of the garden is 84 feet. The length of one side of fencing is 8 yards. What is the area of Jordan's garden?

Answers

Answer:

504 ft

Step-by-step explanation:

Perimeter = 2(width) + 2(length)

Convert yards to feet

1yard=3feet

8yards=?

8*3/1 = 24feet

84 = 2(w) + 2(24)

84 = 2w + 42

84 - 42 = 2w

42 = 2w

w = 21

Area = 1 * w

        = 21 * 24

        = 504 ft

A building has 40 apartments on 5 floors

what is the unit rate?

Answers

Answer:

8 is the right answer

Step-by-step explanation:

because 40 devided by 5 is 8

8 is the answer bc you would decide 40 by 5

Daniel kicks a soccer ball and the trajectory is modeled by f(t) =− 16t^2+ 32t .

a. What would the value be of f(1)?
b. If it takes 2 seconds for the ball to hit the ground, what would a reasonable domain be for this function?

Answers

Answer:

f(1) = 16

Domain: 0 ≤ t ≤ 2

Step-by-step explanation:

Given

f(t) = -16t²+ 32t

Solving (a): f(1)

Substitute 1 for t in f(t)

f(t) =− 16t²+ 32t .

f(1) =− 16 * (1)²+ 32 * 1

f(1) = -16 * 1 + 32

f(1) = -16 + 32

f(1) = 16

Solving (b): The domain

The implication of the given parameter in (b) is that t ≤ 2.

Since t represents time, t can't be negative.

Hence, a reasonable domain is

0 ≤ t ≤ 2

Two bikers rode at a constant speed on a 150-meter track. The data here show each biker’s distance for a certain part of the race. Who won the race and by how much?

Student 1

A 2-column table with 4 rows. Column 1 is labeled Time (seconds) with entries 4, 6, 8, 10. Column 2 is labeled Distance (meters) with entries 40, 60, 80, 100.


won the race by about
.

Student 2

A graph has time (seconds) on the x-axis and Distance (meters) on the y-axis. Points are at (4, 42), (6, 63), (8, 84) and (10, 105).

Answers

Answer:student 2

1 second

Step-by-step explanation:

i took the test

Answer:

student 2 ..... 1 second

Step-by-step explanation:

i did the assignment on edg2020

What is the remainder when a^3 - 4 is divided by a+2?
a)0
b)-6
c)-2
d)-12

Answers

Answer:

The remainder is -12. Choice d)

Step-by-step explanation:

The Remainder Theorem

The polynomial remainder theorem states that the remainder of the division of a polynomial f(x) by (x-r) is equal to f(r).

We have the polynomial

[tex]P(a)= a^3 - 4[/tex]

To evaluate the remainder when P is divided by a+2, we only have to find P(-2):

[tex]P(-2)= (-2)^3 - 4[/tex]

[tex]P(-2)= -8 - 4=-12[/tex]

The remainder is -12. Choice d)

What is the value of G-3=9

Answers

Answer:

G=12

Step-by-step explanation:

Answer:

12

Step-by-step explanation:

Step 1:

g - 3 = 9     Equation

Step 2:

g = 9 + 3      Add 3 on both sides

Answer:

g = 12

Hope This Helps :)

The density of matter is calculated using the formula p = ", where p is the density in grams per cubic centimeter, m
is the mass in grams, and V is the volume in cubic centimeters. If a sample of 105 grams of silver has a density of 10.5
grams per cubic centimeter, what is the volume of the sample, in cubic centimeters?
0.01
O 0.1
O
1
10

Answers

Answer:

Volume = 0.1 cu. cm.

Step-by-step explanation:

p = m V

where p = 10.5 grams/cu. cm.

          m = 105 grams

plugin values into the equation:

10.5 grams/cu. cm. = 105 grams V

V = 10.5 grams/cu. cm.

         105 grams

V = 0.1 cu. cm.

OK i dont know what time it is for you so its 5:40 am but here another question.
I have $40.50
If i went to a store and got 3 boxes of popcorn ( $15.99)and 3 milk jugs ($12.99).Then get a pack of gum ( $1.99).Plus tax ( $4.99) add to everything.Hint plus all money then add $4.99 three times.

Answers

Answer:

Question wasn't specific enough but I believe the cost=$93.92

Step-by-step explanation:

15.99*3=47.97

12.99*3=38.97

plus 1.99 and 4.99, add them all together

47.97+38.97+1.99+4.99=93.92

The answer is: x is choose your answer

Answers

Answer:

All real numbers

Let's find the critical points of the inequality.

−4x+7=17

−4x+7+−7=17+−7(Add -7 to both sides)

−4x=10

−4x−1=10−1

(Divide both sides by -1)

4x=−10

4x=−10(Solve Exponent)

log(4x)=log(−10)(Take log of both sides)

x*(log(4))=log(−10)

x=log(−10)log(4)

x=NaN

PLEASE HELP! I don’t understand how to do it :(

Answers

r/s ×3

calculate the product

r×3/s

use the commutative property to reorder the terms

Answer : 3r/s

PLEASE MARK ME AS BRAINLIEST

Answer:

hi I did not fully understand, so I did it on the calculator

The difference between a number x and 3 is at least nine Write an inequality for the following sentence.

Answers

Answer:

3 - x ≥ 9

Step-by-step explanation:

At least in inequality means greater than or equal to (≥)

Difference in mathematics means subtraction

The difference between a number x and 3

3 - x

is at least nine

3 - x ≥ 9

The inequality for the sentence is

3 - x ≥ 9

A lighthouse cast a shadow of 12 feet. A nearby lamppost measures 5.25 feet tall and cast a shadow of 8 feet. What is the height of the lighthouse to the nearest tenth?

Answers

7.88 feet is the height of the lighthouse

Einstein once developed the formula, E = mc2, to describe the theory of relativity, where E is the total energy in the system, m is the total mass, and c2 is the speed of light. If the equation was to be rearranged in order to solve for the total mass, which formula below should be used?

A - m = E/c2
B - m = E — c2
C - m = Ec2
D - m = E + c2

Answers

Answer:

The formula which should be used is  [tex]m=\frac{E}{c^{2}}[/tex] ⇒ A

Step-by-step explanation:

To solve an equation of different variables to one of these variables do that

Write the equation and underline the variable you want to solve for itSeparate this variable on one side and all other terms on the other sides

Let us do that with the question

∵ E = m

→ E is the total energy

→ m is the total mass

→ c² is the speed of light

∵ We need to solve the equation for the total mass m

→ We need to take c² to the other side

∵ c² is multiplied by m

∴ Divide both sides by c² to move it from the right side to the left side

∴ [tex]\frac{E}{c^{2}}=\frac{mc^{2}}{c^{2}}[/tex]

→ Cancel c² with c² on the right side

∴ [tex]\frac{E}{c^{2}}=m[/tex]

→ Switch the two sides

∴ [tex]m=\frac{E}{c^{2}}[/tex]

The formula which should be used is  [tex]m=\frac{E}{c^{2}}[/tex] ⇒ A

Solve the following equation for a.

a-f=q

Answers

Answer:

a=q+f

Step-by-step explanation:

1. a-f=q

2. you need to do the opposite of -f which is +f to cancel it out

after that you need to do the +f to the q

Hope this helps

Using the literal equation a-f = q, the solution for a = p + q

What is literal equation?

A literal equation are  type of equations which have two or more unknown variables . A literal equation can be solved by adding or subtracting or multiplying or divide by same numbers to the both sides of the equation in order to solve the expression for the required variable.

For example if an given equation is x+ y =2 and we want to solve it for y

Then we will try to keep y on one side and take remaining terms to other side.⇒ y = x-2  is solution for y.

Given equation :

a- f = q

To solve for a, add f to both sides

⇒ a- f +  f = q+ f

⇒ a = q + f

Solution for a is q +f.

Also, Learn more about the literal equation from the link below:

brainly.com/question/18262264

#SPJ2

3.The snow starts at a depth of 10 inches and melts to 2 inches over the span of 4 hours. Determine the rate of change over the interval 0≤x≤4A.4 inches per hour

B.2 inches per hour

C.8 inches per hour

D.12 inch per hour

4.The population in a neighborhood increased from 120 to 156 people from 1990 to 1994. Find the rate of change over the interval 1990≤x≤1994.

A.1/9 of a person per year

B.9 people per year

C.36 people per year

D.4 people per year

5.The temperature increases from 60 degrees Fahrenheit to 84 degrees Fahrenheit from 8 in the morning to 12 in the afternoon. Find the rate of change over the interval 8≤x≤12

A.16 of a degree Fahrenheit per hour

B.4 degrees Fahrenheit per hour

C.6 degrees Fahrenheit per hour

D.24 degrees Fahrenheit per hour

If you answer, answer with all of the questions listed thank you.

Answers

3. B: 2 inches

4. C: 9 people

5. B: 6 degrees

Please answer 10 point + brainlyest = 1 big thank u

Answers

Step-by-step explanation:

FIRST, we want to understand every property:

Associative Property: The associative property states that you can add or multiply regardless of how the numbers are grouped so (5 + 4) + 3 = 5 + (4 + 3)

Commutative Property: Commutative is the one that refers to moving stuff around so 3 + 2 = 2 + 3

Additive Inverse Property: This is the number that when added to the original number, equals 0 or it's the opposite of the number so 5 <- is the original number and -5 <- is the additive inverse.

Simplify: Is just to add like terms, and make the equation the simplest.

1. ORIGINAL EXPRESSION

2. Additive Inverse Property

3. Commutative property

4. Associative Property

5. Simplify

6. Simplify

Write a rate as a unit rate.

1,300 people on 5 planes

Answers

Answer:

260 people for every plane

Step-by-step explanation:

divide the ratio of people to the ratio of planes

1300/5=260/1(Dont need to write the 1,Only if stated or neccessary)

Answer:

260

Step-by-step explanation:

1300/5

=260

Other Questions
What is the difference between 9 and -2?711-7-11 Write the ratio in simplest form.12:18please help meeee ! !!HELP!! A coral reef, like the one shown in the photo, is a structure composed of the calcium carbonate exoskeletons of corals, a type of animal. Which term best characterizes the role of corals in a coral reef ecosystem? On the periodic table, why are all noble gases placed in column 18 (8A)?A.Noble gas elements have identical molar masses.B.Noble gases are all rarer than elements in other columns.C.The noble gases only chemically react with other noble gases.D.The valence electron configuration is similar in all noble gas elements. The model represents an equation.What value of x makes the equation true? HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell