How many molecules in a mole?​

Answers

Answer 1

Answer:

One mole of a substance is equal to 6.022 × 10²³ units of that substance (such as atoms, molecules, or ions). The number 6.022 × 10²³ is known as Avogadro's number or Avogadro's constant.

Explanation:

hope this helped!


Related Questions

Pleaseeeee answer quick
The most reactive metals are located in wwhich area of the periodic table?
A.top
B.far left
C.far right
D.center

Answers

Answer:

B

Explanation: Lithium, sodium, and potassium, etc. all react with water

Lower left is where the most active metals are found

determine the energy in joules of a photon whose frequency is 3.55 x10^17 hz( with units)

Answers

i think it is this

Explanation:

6. Would a short-term or long-term change allow for an adaptation?

Answers

Answer:

long term change

Explanation:

because it takes time

which characteristics of an element can be determined by considering only the element’s specific location on the periodic table?

Answers

Answer:

Gas, Solid, or liquid

Explanation:

The number of electron shells tell us which group it’s in and the number of electrons in total (atomic number) tell us exactly where it is

Which of the following is true about science and technology? A. Advancements in science cannot lead to advancements in technology, but technological advancements can lead to scientific advancements. B. Advancements in science can lead to advancements in technology, and technological advancements can also lead to scientific advancements. C. Advancements in science cannot lead to advancements in technology, and technological advancements cannot lead to scientific advancements. D. Advancements in science can lead to advancements in technology, but technological advancements cannot lead to scientific advancements.

Answers

Answer:

c is the answer i am positive about that is it is wrong correct me plz

Explanation:

The volume of CO2 at 99.3 kPa was measured at 455 cm3. What will the volume be if the pressure is adjusted to 202.6 kPa?

Answers

Answer:

The answer is 223.0 cm³

Explanation:

To find the volume when the pressure is at 202.6 kPa we use Boyle's law which is

[tex]P_1V_1 = P_2V_2[/tex]

where

P1 is the initial pressure

P2 is the final pressure

V1 is the initial volume

V2 is the final volume

Since we are finding the final volume

[tex]V_2 = \frac{P_1V_1}{P_2} \\[/tex]

From the question

P1 = 99.3 kPa = 99300 Pa

V1 = 455 cm³

P2 = 202.6 kPa = 202600

So we have

[tex]V_2 = \frac{99300 \times 455}{202600} = \frac{45181500}{202600} \\ = 223.008390...[/tex]

We have the final answer as

223.0 cm³

Hope this helps you

In what way is a decomposing log in a forest a microhabitat ? It supports small organisms within a habitat, while the forest houses the log itself It supports small organisms within a habitat, while the forest houses the log itself it provides camouflage for organisms to protect themselves it provides camouflage for organisms to protect themselves it decomposes matter that enriches the soil it decomposes matter that enriches the soil it is a large community of organisms that occupy a large habitat

Answers

Answer:

A microhabitat is a small or localized ecosystem in a larger ecosystem where a range of small populations of plants and animals sustain and main a micro-ecosystem.

Rotting or decomposing log is an example of the microhabitat as it provides food shelter, and various plants and organisms found and interact to make it an ecosystem. There are also interactions between biotic and abiotic factors. Many other characteristics present in this small ecosystem as given in the question.

A microhabitat is a small or localized ecosystem in a more extensive ecosystem a range of small populations of plants, animals sustain main a micro-ecosystem.

What is a Micro-ecosystem?

A rotting or decomposing log is an illustration of a microhabitat as it nourishes food shelter, and different plants and organisms found and interact to create an ecosystem. There are also interchanges between biotic and also abiotic factors. Multiple different characteristics are present in this small ecosystem as given in the question.

Find more information about Micro-ecosystem here:

https://brainly.com/question/26925920

which phrase describes a gas?

Answers

Answer:

Gas is a state of matter where particles flow freely. It has no definite shape or volume.

Explanation:

How is the Separation of a Compound different
from that of a mixture?

Answers

a compound is chemically combined and can only be separated by chemical processes. Therefore, it is much harder to separate a compound than a mixture. H2O or water is a compound and Kool-aid is a mixture.

heavy vechicle have back wheels in pairs. why​

Answers

because without the extra wheels the vehicle would be to heavy and not be able to support the extra weight thus the vehicle would be useless hope this helped brainlies plz

If an atom has 56 protons and 58 neutrons, how many electrons
would this atom have?

Answers

Because the protons = the electrons so the atom will have 56 electrons.

This atom would have 56 electrons.

Atomic Structure:

In a neutral atom, the number of protons and number of electrons are same which is equal to the atomic number of an atom.The mass number of the atom (M) is equal to the sum of the number of protons and neutrons in the nucleus.

So, it is given that;

Number of protons=56

Number of neutrons=58

Thus, number of electrons=56 (since, the number of protons and number of electrons are same)

Learn more:

brainly.com/question/18320794

In paper chromatography, is the substance being tested the solute or the solvent?

Answers

Answer:

Explanation:

This is an awfully good question. Think carefully about which is which.

A solvent is something that will dissolve the solute.

So the solvent will carry the solute up (say) chromatography paper. It is the solute.

how many minutes are in 9,040 ms

Answers

Answer:

0.15066667

I tried, hope this helps :)

How much will it cost in American dollars(USD) to fill a 15 gallon tank of gasoline in Canada, if the price of gasoline there is $1.07 Canadian dollars (CAD) per liter. The current exchange rate is ($1.00(USD)= $1.34(CAD), 1 L=1.06 qts, 1.61 Km= 1 Mile, 1 gal= 4 qts]​

Answers

Answer:

It will cost 45.37 US dollars (USD) to fill a 15 gallon gas tank in Canada.

Explanation:

Two values ​​are directly proportional when when one value increases, the other increases in the same proportion, or when one value decreases, the other decreases in the same proportion.

The rule of three makes it possible to solve proportionality problems effectively and quickly. It is a method of calculating an unknown value that is directly proportional to another known value.

Then, knowing the data a, b and c, and the fourth unknown data x, which will be the unknown to be solved, this value is calculated as:

a ⇒ b

c ⇒ x

So: [tex]x=\frac{c*b}{a}[/tex]

You must calculate the cost in US dollars (USD) to fill a 15 gallon gas tank in Canada. You know that the price of gasoline is $1.07 Canadian dollars (CAD) per liter. If 1 L equals 1.06 qts, then you can say that the price of gasoline is $ 1.07 Canadian dollars (CAD) per 1.06 qts.

You can now apply a rule of three as follows: if 4 qts is equal to 1 gal, 1.06 qts is equal to how much gal is?

[tex]gal=\frac{1.06 qts*1 gal}{4 qts}[/tex]

gal= 0.265

Then you can say that the price of gasoline is $ 1.07 Canadian dollars (CAD) per 0.265 gal.  So you can apply the following rule of three: if 0.265 gal costs $ 1.07 Canadian dollars (CAD), 15 gal how many Canadian dollars cost?

[tex]CAD=\frac{15 gal*1.07 CAD}{0.265 gal}[/tex]

CAD= $60.8 CAD

Finally, you can apply the following rule of three: if $ 1.34 (CAD) is equal to $ 1.00 (USD), $ 60.8 (CAD) is equal to how many US dollars (USD)?

[tex]USD=\frac{60.8 CAD*1USD}{1.34 CAD}[/tex]

USD=   45.37

It will cost 45.37 US dollars (USD) to fill a 15 gallon gas tank in Canada.

Which are the basic physical sciences?
biology, paleontology, biochemistry and zoology
medicine, biotechnology, genetics and pharmacology
chemistry, physics, astronomy and earth science
Correct.
mathematics, statistics, logic and computer science

Answers

The correct answer is:

Chemistry, physics, astronomy and earth science.

Answer:

Chemistry, physics, astronomy and earth science.

Explanation:

Explain why mixtures can be separated by physical methods, such as sieving and distillation.

Answers

Well like some mixtures, like Oil and water, they can not be mixed because the substances will separate and the oil will just sit at the top.

state one factor that effects the rate of change of the liquid colour​

Answers

Answer:

Temperature is one of the major factors that affects the rate of change of the liquid colour, this is because ; like when if you freeze hot water the ice formed will be clear transparent, while on the other hand, if we freeze cold water it would be foggy inside the ice. This change occurs because of the temperature difference of the cold and hot water.

If my answer helped, kindly mark me as the brainliest!!

Thank You!!

2. Predict which food sample you think has the most stored energy
Explain.
Type your answer here.
TT
B 1
IC

Answers

Answer:

carbohydrate yam rice

B 1 strongest food energy lik

kinetic energy is energy that an object possesses because of its

Answers

Answer:

Explanation:

Kinetic energy is the energy possessed by an object due to its motion. If an object is moving, then it has kinetic energy. If an object has kinetic energy, then it is moving. Many students confuse kinetic energy with potential energy.

Increasing the temperature of gas in a container that cannot expand is a way to _______. decrease the volume of the gas decrease the volume of the gas increase the pressure of the gas increase the pressure of the gas decrease the pressure of the gas decrease the pressure of the gas increase the volume of the gas

Answers

Answer:

Increase the pressure of the gas

Explanation:

According to the Pressure law, for a fixed mass of gas, at a constant volume (V), the pressure (P) is directly proportional to the absolute temperature (T).

From the kinetic molecular theory, gases are composed of particles which are in constant motion, colliding with themselves as well as with the walls of their container.

When the temperature of these gas molecules is increased, the molecules acquire more kinetic energy and the rate of collisions increases. Since the container cannot expand, the increase in pressure is due to the increase in collisions between the molecules of the gas as well as with the walls of their container.

Answer:

False

Explanation:

Its F

Write a complete, balanced chemical equation where tin metal reacts with aqueous hydrochloric acid to produce tin(II) chloride and hydrogen gas. Include states.

From the equation, which element is oxidized, and which element is reduced?

Answers

Answer:

Zn(s)+2HCl(aq)→ZnCl2(aq)+H2(g)

Explanation:

The net reaction is Z n ( s ) + 2 H + ( a q ) → Z n 2 + ( a q ) + H 2 ( g ) The C l − ions are spectators - they don't change.

Which of these substances is a mixture?
a: none of these are mixtures
b:Lemonade
c: gold
d: sugar

Answers

B. Lemonade, it's a mixture of sugar, lemon juice, and water

Answer:

Lemonade

Explanation:

Its a mixture of stuff to make a sweat drink :D

Which one is a compound

Answers

Answer:

CO

Explanation:

the rest are elements. CO is made up of one carbon atom and one oxygen atom

Velocity and speed are both measurements of how fast something is moving however velocity is different from speed because
A) velocity and speed are the same thing
B) velocity is usually faster than speed
C) The velocity of an object also tells us the direction something is moving
D) velocity is how fast something is changing its speed

Answers

Im pretty sure the answer is d

Answer:

C

Explanation:

Velocity is a vector quantity I.e it has magnitude and direction

Speed on the other hand is a scalar quantity I.e it has only magnitude

Is this a compound,mixture or solution? (10 points)

Answers

Answer:

it is a compound it is a solution when they say they are ablle to seperate it give out they did not mix it

Explanation:

The density of a gas is 0.68 g/mL. What amount of space would 23.8 g of this gas occupy

Answers

Answer:

Density of the gas = Mass/Volume
Mass = 0.68g/mL
Volume = 23.8g
So, Density of the gas:
= (0.68/23.8)g/mL
= 2.85g/mL

calculate the number of molecules in 52 gram of helium​

Answers

Answer:

The molar mass that is the mass of 6.022 X 1023 atoms of helium is 4g. Hence 1 mole of He = 4 g of He = 6.022 X 1023atoms of He.

1 g of He = (6.022 X 1023) / 4 atoms of He.

52 g of He = (6.022 X 1023X 52 ) / 4 atoms of He.

Explanation:

why can't you turn pancakes back into the ingredients

Answers

Answer:

heat is added making it a chemical change

Explanation:

Answer:

With pancakes, the chemical reaction is between a leavening agent – such as baking soda & baking powder – & an acidic ingredient – such as buttermilk – producing tiny bubbles of carbon dioxide gas. These bubble form throughout the pancake, and are trapped as the batter cooks and solidifies

Explanation:

since there is a chemical reaction the pancakes cant be changed back into the ingredients after done.

What is the primary type of heat transfer?: A cool breeze blows off the water.

Answers

Answer:

Explanation:

Heat transfer occurs by three main mechanisms: conduction, where rigorously vibrating molecules transfer their energy to other molecules with lower energy; convection, in which the bulk movement of a fluid causes currents and eddies that promote mixing and the distribution of thermal energy

What does nm measure in the spectra?

Answers

Answer:

The nanometre (international spelling as used by the International Bureau of Weights and Measures; SI symbol: nm) or nanometer (American spelling) is a unit of length in the metric system, equal to one billionth (short scale) of a metre (0.000000001 m).

Answer: Nanometer

Explanation:

The nanometre (international spelling as used by the International Bureau of Weights and Measures; SI symbol: nm) or nanometer (American spelling) is a unit of length in the metric system, equal to one billionth (short scale) of a metre (0.000000001 m).

...

Nanometer

imperial/US units 3.2808×10−9 ft 3.9370×10−8 in

Other Questions
According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change? can you plzzzzzzzzzzzz help me What is 6/20 of a dollar BRAINLIEST IS RIGHT WILL BE MARKED BRAINLIEST AND PLUS 12 POINTS Which detail from the passage best explain why plants photosynthesize? Let S = {1, 2, 3, 4, 5, 6, 7, 8, 9), A = { 1, 2, 3, 4, B= {2, 4, 6, 8} andC= {3, 4, 5, 6). Find (i) A (ii) An C (iii) (An CY (iv) A UB (V) BIC What is the slope of the line that passes through the points (3,5) and ( 1, 5)? Write your answer in simplest form. Which choice shows the correct sequence or order of events for a scientific experiment?A) Perform experiment -> Form hypothesis -> Analyze data -> Draw conclusions B) Analyze data -> Form hypothesis -> Perform experiment -> Draw conclusions C) Perform experiment -> Analyze data -> Draw conclusions -> Form hypothesis D) Form hypothesis -> Perform experiment -> Analyze data -> Draw conclusions