Answer:
The medical and scientific visionaries who planned the Human Genome Project Already, doctors can better categorize some cancers by examining the outside of the protein-coding regions of our DNA, for example in the robust medical informatics tool that healthcare providers can readily use to
Explanation:
Which of these occurs in sexual reproduction but not in asexual reproduction?
a
The genetic information is identical to the parents.
b
The offspring are made of cells.
c
The genetic information comes from the parents but is not identical.
d
The offspring inherit traits from the parents.
Answer:
c
Explanation:
Only in asexual reproduction the genetic information is identical. Sexual produces genetics that are combination of both parents, producing non-identical offspring.
The human body is made up of several
systems. Each of these systems works
together to maintain homeostasis in the
organism. For example, the respiratory
system takes in oxygen and the oxygen is
transported through the body by the
cardiovascular system. The human body is
an example of
A. an open system.
B. a closed system.
C. a neutral system.
need help asap, will mark brainliest. PLSSS
How would an increase in the amount of solar energy available most likely affect a terrestrial community?
The amount of atmospheric carbon would decrease.
The amount of nitrogen in biomass would decrease.
The amount of sedimentary phosphorus would increase.
The amount of water in reservoirs would increase. (ik its not this one)
How does the motion of particles in a gas change as the gas cools? (1 point)
They move more slowly.
b
They move in a more circular pattern.
ос
They move faster.
d
They move more randomly.
Identify the structures of plants usually involved in vegetative reproduction
Answer:
b
Explanation:
dnakebtearyrea
When two organisms from the same species compete for resources, it is______ competition.
Answer:
Intraspecific competition
Hope this helps!
Answer:
Competitive exclusion principal applies.
Explanation:
Basically, the chances of both species being equally successful is almost impossible. Chances are one will lose and will either leave empty-handed, injured, or won't live to leave at all.
what is the term for the process of cell division that results in the formation of gametes ?
Answer:
meiosis
Explanation:
A biologist counts the number of rabbits in a population each year and observes a decrease in population. Since the coyote population has exploded, the biologist concludes that the coyote population has had a negative impact on the rabbit population. Which describes the biologist’s actions?
experimentation
inference
observation
interacting
Answer:
Inference
Explanation:
edg 2021
Answer:
inference
Explanation:
I got it correct on teams
10. Name the pigments present in plants which can absorb solar energy.
11. Name the two stages of photosynthesis.
12. Why is nutrition necessary for an organism?
13. Which pancreatic enzyme is effective in digesting proteins?
14. Which enzyme present in saliva breaks down starch?
15. What is the role of acid in our stomach?
16. What is the role of saliva in the digestion of food?
17 State the function of digestive enzymes.
18. Where does digestion of fat take place in our body?
19. What is the mode of nutrition found in human beings?
Answer:
10. chlorophyll
11. There are two main stages of photosynthesis: the light-dependent reactions and the Calvin cycle.
12. Nutrition is necessary for the growth of new cells and the replacement or repair of worn-out cells. Nutrition gives energy for different metabolic processes in the body. Nutrition is required to produce resistance against different diseases.
13. trypsin
14. salivary amylase
15. Hydrochloric acid helps your body to break down, digest, and absorb nutrients such as protein. The hydrochloric acid found in the stomach facilitates digestion by disintegrating complex large food molecules into simpler molecules. The acid activates the pepsinogen enzyme required to digest proteins.
16. Saliva, the watery liquid produced by glands located under the tongue, is an essential component of the digestive process. Saliva is 98% water, so it moistens the mouth and helps compact food into softened particles for easier swallowing.
17. Digestive enzymes play a key role in breaking down the food you eat. These proteins speed up chemical reactions that turn nutrients into substances that your digestive tract can absorb. Your saliva has digestive enzymes in it. Some of your organs, including your pancreas, gallbladder, and liver, also release them.
18. small intestine
19. heterotrophic
hope this answer helps you...
please mark as brainliest...thank you!
Which statement best describes the movement of ocean waves? Water moves across the ocean's surface water remains in the same place as wave (energy) travels through it water moves because there is a difference in density of the water creating a wave none of these
Answer:
water remains in the same place as wave (energy) travels through it
Explanation:
Winds influence the ocean and its movements. Air current running on the ocean surface transfers energy to water. A wave is nothing else than energy. When the winds provide energy to the water surface and produce waves, it occurs a particular water molecules´ motion. They move in circles from up to down, up to a certain depth, and go back to the surface. And they do so while energy from the wave is passing through. Waves are the ones that move through the ocean until they reach the shore, where the energy is transferred to land. Water molecules remain in the same general area, while energy travels from molecule to molecule as a wave.
WILL GIVE BRAINLIEST IF CORRECT
Roses now come in several colors such as orange and purple. Which process are florist most likely to use in creating these new flowers?
a. Genetic cloning
b. Protein synthesis
c. Artificial selection
d. Asexual reproduction
LOOK AT PIC!!!!!!!!!!!!!
Answer: black
Explanation:
Yes
Answer:
wow it is blank
Explanation:
How does type 1 diabetes affect the cardiovascular system?
Answer:
diabetes can damage your blood vessels and the nerves that control your heart and blood vessels, causing to have a bad affect on your cardiovascular system.
What are some things you think would help identify a fossil? *
Answer: by studying the Fossil record we can tell how long life has existed on earth,and how different plants and animals are related to each other.often we can work out how and where they lived, and use this information to find out about ancient environments fossils can tell us about a lot about the past.
Explanation: If you like it please mark brainlest....
Those individuals that are better able to survive in the Environment tend to be:
Answer:
Fit
Explanation:
They are the ones who are strong enough to survive.
HELP!!!!!!
What percentage of the dogs will have a solid color
Answer:
75%
Explanation:
Which organisms are secondary consumers in this food web? Select all that apply
Rockskipper, Pufferfish and Peacock Flounder are secondary consumers in this food web. So, the correct options are A, B and C.
What is Food web?A food web is a diagram that shows what is eaten with what in an ecological context and how food chains naturally connect to one another. Consumer-resource system is another term for the food web.
A food web is a comprehensive account of the species that make up an ecosystem and their interactions with one another. It demonstrates how energy is moved along food chains that are connected to other food chains.
After primary consumers, who are primarily herbivores, are omnivores, carnivores, and secondary and tertiary consumers. The apex predators are those animals that have no other predators save humans. They are at the highest point in the food chain.
Therefore, the correct options are A, B and C.
Learn more about Food web, here:
https://brainly.com/question/18816028
#SPJ2
On the diagram below, what is the name of region B?
1. In the diagram, the arrow #9 is pointing to an organelle called
mitochondria
nucleus
smooth endoplasmic recticulum
endoplasmic recticulum
Answer:
Mitochondria
Explanation:
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
A scientist is studying a substance that is cycled through ecosystems. Which of the following substances might the scientist be studying?
soil
copper
glucose
nitrogen
Will report scammers so pls just help me out
can you please answer these questions for me I really need help I am begging you
Answer:
1: 75%
2: 75%
3: 50%
4: 25%
Can angiosperms be considered male or female?
Here's your answer: Their male
All the populations living in one place form a ?
Answer:
A community is all the populations in an area. The terms Population and Community are used in ecology to describe a group of different species inhabiting the same geographical space at a particular time. These diverse organisms stay together because of the need of food.
Explanation: hope this helps
List 4 chordate characteristics.
Answer:
notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail
Explanation:
had to censor second to last word but the 4 is an a
GIVING BRAINLIEST AND THE REST OF MY POINTS!!!! :)
What life cycle adaptation does the desert gold poppy have that helps it reproduce and survive in its dry desert environment?
A) It produces large amounts of spores.
B) It only produces seeds in the summer when it is driest.
C) Its seeds stay dormant until there is enough precipitation for them to grow.
D) It can produce seeds all year round that can grow in dry and wet conditions.
what was explained by darwins theory of biological evolution
Answer:
When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.
Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.
Explanation:
What was explained by it? Evolution. But how did it explain evolution? That is in the answer.
The picture shows a giraffe eating leaves.
Which describes the interaction?
abiotic interacting with abiotic
Obiotic interacting with biotic
abiotic interacting with biotic
Obiotic interacting with abiotic
Answer:
biotic interacting with biotic
Explanation:
both the giraff and leaves are living and both are biotic
8. Which is an example of a medium of communication?
in an office setting
letting people know that Fridays will not have casual dress
a formal speech at a meeting
a person objecting to a point that has been made
What is true about one strand of DNA?
It contains many chromosomes.
It contains many proteins.
It contains many pieces of RNA.
It contains many genes.
Answer:
it contains many genes.
Answer:
D: It contains many genes
