Does Genetic Modified Organism ( GMO ) make an apple bigger?​

Answers

Answer 1

Answer:

the data only can determine the based on the replica of the fruit.

Explanation:

when fruit is genetically modified it's genetically is copied and the process of growing is sped up. in some since the fruit can change in size due to the result of multiple gene copies.

hope this helps!


Related Questions

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

What is often a problem when calibrating a molecular clock?
A. There are frequently not enough negative mutations to accurately calibrate the clocks.
B. There are many different clocks, each of which "ticks" at a different rate.
C. The clocks use mutations that are difficult to identify and track.
D. The frequency of crossing over is used to calibrate the clocks.​

Answers

Answer:

cevabın C olduğunu düşünüyorum

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect does this mutation have on the individual? WILL GIVE BRAINLIEST
The individual suffers from sickle cell anemia.

The individual suffers from myotonic dystrophy.

The individual suffers from Fragile X syndrome.

The individual suffers no negative effects.

Answers

i believe it to be the first one

Answer:

The individual suffers from sickle cell anemia.

Explanation:

Deformed red blood cells occur in 1 in 500 African Americans. This is caused due to a gene mutation called point mutation that alters the structure of the red blood cell. This alteration affects the cell's ability to carry oxygen.

The farmer realizes he could sell mini-dragons as pets, but doesn't want them to breathe fire, because that would be dangerous. Suggest two parental genotypes for parents that would produce mini, non-fire breathing dragons.

Answers

Answer:

ddff  and DDFf

Explanation:

From the information given:

Let DD represents the dwarf traits and FF represents the ability for the dragons to breathe fire.

Also, if dd represents the normal traits and ff represents the inability of the dragons to breathe fire.

Then; we can cross a dominant trait for dwarfism which has a heterozygous trait for fire with a recessive trait of normal and nonfire.

The two parental gametes are: ddff  and DDFf

Using a Punnet Square:

         DF              Df

df      DdFf           Ddff

df      DdFf           Ddff

From above; we could observe that the proportion of progenitors that will be dwarf and at the same time unable to breathe fire is 50%.

Put "Genetic Variation" in a sentence

Answers

Answer: British populations lack detectable genetic variation, suggesting a strong founder effect.

hope it will be helpful.

Mutations can often cause genetic variation.


Hope that helps!

PLS HELP ILL MARK BRAILIEST
Spend one minute writing an explanation of
the FUNCTION of enzymes. YOU MUST USE
THE WORDS CATALYST, ACTIVATION
ENERGY, RECYCLABLE

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions. Activation energy is the energy needed to start a chemical reaction. This is illustrated in Figure below. The biochemical reaction shown in the figure requires about three times as much activation energy without the enzyme as it does with the enzyme.

The reaction represented by this graph is a combustion reaction involving the reactants glucose (C6H12O6) and oxygen (O2). The products of the reaction are carbon dioxide (CO2) and water (H2O). Energy is also released during the reaction. The enzyme speeds up the reaction by lowering the activation energy needed for the reaction to start. Compare the activation energy with and without the enzyme

Answer:

Enzymes help speed up chemical reactions in the human body. They bind to molecules and alter them in specific ways. They are essential for respiration, digesting food, muscle and nerve function, among thousands of other roles.

What is the function of an enzyme? They allow chemical reactions to occur at normal body temperature fast enough to sustain life. They reduce the activation energy needed to start a chemical reaction.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

Enzymes create chemical reactions in the body. They actually speed up the rate of a chemical reaction to help support life. The enzymes in your body help to perform very important tasks. These include building muscle, destroying toxins, and breaking down food particles during digestion.

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

In three to five sentences, construct an argument that shows why lichens are necessary to establish a new ecosystem after an extreme disturbance.
I would really appreciate it if someone o two people would help me out on this one

Answers

Answer:  Lichens affect every species in the ecosystem, in 2013 Russia had a dramatic lichen die off which caused 61,000, 20% of the entire reindeer population to die from starvation. And with fewer deers, the bears and wolves also suffered from the loss of lichens and if it takes a long time for lichens to grow back in an ecosystem, animal declines may take years if ever to be corrected.  Lichens serve as a basis for several food chains, especially in artic communities.

The argument which shows why lichens are necessary to establish a new ecosystem is as follows;

Lichens are known to enable algae to live all over the world in many different climates.

On this note, lichens also provide a means to convert carbon dioxide in the atmosphere through photosynthesis into oxygen, a process required by all to survive.

Additionally, lichens provide us with valuable information about the environment around us.

On this basis, lichens are important for establishing a new ecosystem after an extreme disturbance.

Read more on lichens and the ecosystem;

https://brainly.com/question/1504278

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST


ste
Class
Lesson Uutine
Levels of Organization
A Lite's Organisation
1. A large animal is composed of trillions of tiny
together
organisms are made of only one cell.
working

Answers

Answer:Life's Organization. 1. A large animal is composed of trillions of tiny cells working together. 2. Unicellular organisms are made of only one cell. B.

Explanation:

Please help due in 10 minutes!!!
Explain the 5 ways to reach Hardy-Weinberg equilibrium, does this mean evolution is occurring?

Answers

There are five basic Hardy-Weinberg assumptions: no mutation, random mating, no gene flow, infinite population size, and no selection. If the assumptions are not met for a gene, the population may evolve for that gene (the gene's allele frequencies may change).

4.Paramecium is able to move by hairlike structures called
____

Answers

Answer:

Cilia

Explanation:

           

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

1. Shivering when you are cold is an example of your body trying to maintain
homeostasis.
a. True
b. False

Answers

Answer:

true

Explanation:

When the core body temperature drops, the shivering reflex is triggered to maintain homeostasis. Skeletal muscles begin to shake in small movements, creating warmth by expending energy. Shivering can also be a response to a fever, as a person may feel cold.

SOMEONE PLEASE ANSWER OMG



Considering that different types of cells have different rates of mitosis,
which of the following would be a correctly finish this statement? Cell
types like skin and hair are damaged and need replaced more often than
liver cells; therefore ......
Liver cells would have MORE cells doing Mitosis and Apoptosis compared to
Skin/Hair cells
Liver cells would have LESS cells doing Mitosis and Apoptosis compared to Skin/Hair
cells
Liver cells would have the SAME amount of cells doing Mitosis and Apoptosis
compared to Skin/Hair cells

Answers

Answer:

OMGGGGHHHHVGGGGGGGGG

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed
Other Questions
if anyone is able to help please do :) Mia read x pages in the book. Laurie read 1/3 more than that A 2-column table with 5 rows. Column 1 is labeled Days with entries 1, 2, 3, 4, 5. Column 2 is labeled miles with entries 6, 12, 18, 24, 30.Which scenario matches the relationship shown in the table?Sakura walked 6 miles yesterday.Sakura walks 6 miles every day.Sakura walked less than 6 miles.Sakura walked 1 day in 6 miles. 1. Hay una secretaria que (tener) lentes grandes.2. No creo que (haber) una secretaria con lentes grandes. 3. Espero que la maestra no (estar) aqu. 4. La maestra (estar) aqu hoy. 5. Es cierto que mi pap (ser) doctor. 6. No es cierto que mi pap (ser) malo.7. Me alegro de que t (haber) encontrado tus llaves. 8. Miguel (haber) encontrado sus llaves. 9. Yo dudo que Mariana (saber) la verdad.10. Yo pienso que tu prima (ser) bonita.11. Es posible que tu prima (ser) bonita pero yo no s.Please help due in 30 mins During G1, there is a great amount of protein _____________________ occurring. A boy sets up a picnic on the beach next to a sand dune. How are sand dunes formed?A. erosion and depositionB. weathering and erosionC. tectonic platesD. precipitation CALCULUS: Find the velocity, v(t), for an object moving along the x-axis if the acceleration, a(t), is a(t) = cos(t) - sin(t) and v(0) = 3.A. v(t) = sin(t) + cos(t) + 3B. v(t) = sin(t) + cos(t) + 2C. v(t) = sin(t) - cos(t) + 3D. v(t) = sin(t) - cos(t) + 4I picked A., which was marked wrong, although I truly believe that is the answer because I got sin(t) - (-cos(t)) + 3. Please tell me whether you believe this is right or am I doing something wrong. I really want to learn/master this concept. Thanks is advance. A machine paints 360 toy boats in 45 MINUTES. Write the expression that represents the unit rate per HOUR HELPP PLEASE W A MATH PROBKEN If x is 6, what is:X +4 wich of the following were inspirations for Romeo and juliet? According to Uniform Commercial Code (UCC) Section 3-312, a certified check or a cashier's check is fully recoverable if the check is _____. Pls help Ill brain-lest ASAP So I have this chorus class and it's about moveable and fixable do PLEASE HELP FAST Why would the Indigenous, Free Blacks, and Slaves want a revolution in 1800's Latin America? Why are all of us considered scientists to some extent?O A. Everyone has questions about the natural world.O B. Everyone writes and tests hypotheses.O C. Everyone takes measurements and collects data.O D. Everyone performs scientific experiments. Explain the process of AMENDING the Constitution. What is the first amendment Assume that two chords in a given circle are the same distance from thecenter of the circle. Which of the following must also be true?oA. They must be diameters.B. They must be parallel.C. They must be congruent.D. They must be perpendicular.SNBMIT Need help on number 26 and 27!! Name three characteristics of Mental/Emotional health.