blue color
A Physical property
B Chemical property


Blue ColorA Physical PropertyB Chemical Property

Answers

Answer 1

Answer:

physical property

Explanation:

because you can use (seeing) as your senses and it has not been combined with anything that can not be pulled apart from it.


Related Questions

hurry ! worth 50 points & brainliest :))


1.) Explain how interest in ancient texts led to demands for Church reform.


2.) Describe the belief in purgatory and explain the reason for the sale of indulgences.


3.) When Machiavelli wrote The Prince in 1513, he faced a lot of criticism. What were the key ideas of The Prince, and how did these ideas influence European rulers?

Answers

Answer:

1. During the renaissance, many thinkers who read the ancient texts and educated themselves started accusing the Catholic Church that it didn't care about people and that and that it was dogmatic, always looking for ways to gather wealth and more power. These ancient texts came from many sources such as Plato and Aristotle from the Western Hemisphere, or as far away as India.

2. People who believe in purgatory believe that there is a place "between" Earth and Heaven, which is just blank--meaning that the soul can neither return to Earth or go to Heaven. Indulgences were meant to be bought in order to assure that the soul would continue on to heaven.

3. The key ideas of "The Prince" were about power and how leaders specifically princes could seek to gain power and also how they could go about maintaining power. These ideas helped to influence European rulers and individuals around the world by promoting this particular type of leadership and power seeking.

Explanation:

Hope this helps!

(got these answers from other fellow Brainly users)

please help #4-#7 from the epic of gilgamesh i will mark brainliest

Answers

Please give me a copy of the text

And I will help u

which one is correct

Answers

Answer:

C

Explanation:

Answer:

C?

Explanation:

feeling ko letter ...........

...

...

which is NOT a characteristic of compound sentence

HELP ME PLZ

Answers

Answer:

either a or b but my best guess would be "b"

Explanation:

hope this helps

Answer: Soooo I looked back at my answer, its wrong. lemme figure it out.

Explanation:

My guess is A or C. Sorry I tried to help but I suck at this.

Honest opinions on community college

Answers

Answer:

Thats all im looking into rn so i say go for it!!! and its just going to save a little money.

Explanation:

Help needed ASAP will give you brainliest and 5 STARS RATE

Answers

the third one, if you add the comma without the when then you would have a comma splice (when you put a comma between 2 independent clauses without a conjunction) adding the when before Cynthia makes the first part a dependent variable  and makes it okay to add the comma!

Hope this helps! :)

Answer:

The second one! Cynthia got a new fish, she named it Nemo.

Explanation:

Hope this helps :))

9. Why are Stephano and Trinculo uneasy in lines 89-92?
A
B
С
D
They suspect that Caliban has tricked them.
They are having doubts about following Caliban's plan.
They hear Ariel's music but cannot see him.
They have forgotten the words to their song.

Answers

Answer:

C) They hear Ariel's music but cannot see him

Explanation:

ANSWER QUICKLY PLZ BEING TIMED!!!
Read the sentences.
What type of context clue is used to define the word
calamities?
The day began with several calamities: Sid spilled his
breakfast onto his lap, the car broke down, and then he
forgot his homework.
synonym
contrast
O explanation
O example

Answers

answer:

synonym

contrast

explanation

example

the answer is: explanation

im sure it is

what is the main reason that our society has accepted the use of these dangerous gases?

Answers

Answer:

because there is no way to get them out of our environment completely

What are the adjectives in the following sentence?
Those hungry pigs crowded into the muddy
pen.

crowded

muddy

hungry

those

into

pigs

pen


Please help these points are for you if you help me it is worth 63 points HELP ME!!

Answers

Crowded middle hungry

The adjectives are “Hungry” "Crowded" and “Muddy”

Adjectives describes a noun (a person, place or thing)

True or false the United States is considered a developed country

Answers

Answer:

False

Explanation:

Answer:

It is considered a developed country.

Explanation:

We have functional power, running water, medicine, a stable economy, no internal tensions, and a stable government.

Where does Rose Gordon live in flowers for algernon

Answers

New York City i think I am sure

Which key details from "R.M.S. Titanic" best support the central idea that people believed the Titanic was unsinkable?

Select the two correct answers.


"The water rises and the band plays ragtime."

"Boxhall fires the last rocket, then leaves in charge of boat No. 2."

"Major Butt helps women into the last boats and waves goodbye to them."

“Stewards finish waking their passengers below; life preservers are tied on; some men smile at the precaution.” I will mark you brainless

Answers

Answer:

"The water rises and the band plays ragtime", and "Stewards finish waking their passengers below; life preservers are tied on; some men smile at the precaution"

Explanation:

Options A and D are correct, I hope this helps you :)

Choose the type of conflict seen in "The Most Dangerous Game" that is the most significant. Develop an argument supporting its importance to the plot of the story using at least 2 references to the text.

Answers

Answer:

Literary conflicts are often taught during ELA units. Building on prior knowledge to achieve mastery level with our students is important. An excellent way to focus on the various types of literary conflict is through storyboarding. Having students choose an example of each literary conflict and depict it using the storyboard creator is a great way to reinforce your lesson!

In this story, the major conflicts arise from General Zaroff's practice of hunting human beings.

Explanation:

Which of the following words best describe the concept of commitment (8 points)

Answers

Answer:

What are the words???

Explanation:

Answer:

I'm pretty sure it is choice

Explanation:

I think this is because when you even start with the idea of making a commitment, you have to make a few choices. Those choices could be:

how you will accomplish this goal.What this goal will beetc.

Which sentence is in imperative voice?

Answers

Do your homework as soon as you get home.

which genre would have a robot as it's main character?

Answers

I’d say some sort of sci-fi genre

What is an aspect of community or culture emphasized in the story in The Story of a Vision

Answers

need a picture to see it or you can look it up on the websites.

How can you make an electromagnet stronger?

Answers

Answer

wrapping the coil around a piece of iron (such as an iron nail) adding more turns to the coil. increasing the current flowing through the coil.

Explanation:

The barking dog woke up the entire neighborhood with his incessant noise

Answers

Answer:

What's the question?

Explanation:

Answer :
What’s the question?
Explanation :
I can’t help if I don’t have a question

Select two reasons the author likely describes Santha’s classmate in such detail in paragraph 9.


The author wants to point out differences in Indian culture and English culture.

The author wants to provide a picture of an Indian girl assimilating to English mode of dress.

The author wants to show the commonalities between the English children and the Indian children.

The author wants to provide information about Indian and English friendships.

The author wants to point out differences between Indian schools and English schools.

Answers

Answer:

The author wants to point out differences in Indian culture and English culture.

The author wants to provide a picture of an Indian girl assimilating to English mode of dress.

Explanation:

Below is an excerpt from paragraph 9 of the attached pdf:

"I suppose there were about a dozen Indian children in the school—which contained perhaps forty children in all—and four of them were in my class. They were all sitting at the back of the room, and I went to join them. I sat next to a small, solemn girl, who didn’t smile at me. She had long, glossy black braids and wore a cotton dress, but she still kept on her Indian jewelry—a gold chain around her neck, thin gold bracelets, and tiny ruby studs in her ears. Like most Indian children, she had a rim of black kohl around her eyes.

The cotton dress should have looked strange, but all I could think of was that I should ask my mother if I couldn’t wear a dress to school, too, instead of my Indian clothes."

What can you infer about the witches from this scene? Use evidence from the play to back up your answer.

Answers

what play and scene is being referred to?

What is the rising action, climax, falling action, and resolution in the play fourteen.

Answers

Answer:

Definition: The part of the plot in a work of literature that follows the climax and ends in the resolution. This is in contrast to the rising action which leads up to the plot's climax. The part of the plot which follows the climax and diminishes tension before the resolution.

Explanation:

Stuff

. A dramatist has three major tools for presenting the facts of a play: antecedent action is that which occurs before the play occurs. Exposition is that part of the play which is not presented dramatically. Once antecedent action and exposition have been isolated, all else may be regarded as present action, which is presented dramatically. What facts are presented in Act One by means of antecedent action? What facts are presented in Act One by means of exposition?e

Answers

Answer: hope it helps you❤

Explanation: The whole historical context of the Salem witch trials and the events that lead up to the mare explained in Miller’s introductory pages, in addition to the facts surrounding the Red Scare, which The Crucible serves as a social comparison to. As far as the plot itself, and not the big picture information, the event of Abigail, Tituba, and Betty dancing and singing in the forest isantecedent, and is not presented but rather insinuated....

is they singular subject or compound subject?

Answers

Answer:

They is singular hope it helps you

Answer:

they is a singular object

Determine whether the vocabulary word is being used correctly in the sentence.
At nearly twenty dollars a loaf, bread prices have become very pensive.

Answers

Answer:

Pensive is NOT being used correctly!

Explanation:

"Pensive" is defined as "engaged in, invloving or reflecting deep or serious thought". How does that have anything to do with bread prices? Clearly, the sentence is describing how the bread prices have rose to a very expensive amount, and pensive has nothing to do with a large amount of money.

If you liked this answer, I'd really appreciate it if you rated it and gave it a Thanks!

I hope this answer helped you! Have a great day and good luck with your schoolwork!

-KittenCat

Creating a garden is more than just planting seeds as it requires building a border, fertilizing soil, digging troughs, and devoting many hours a week.
In which sentence is an ellipsis used correctly?
O 1. Creating a garden... requires building a border, fertilizing soll, digging troughs, and devoting many hours a week.
O 2. Creating a garden is more than just planting seeds as it requires building a border, fertilizing soil, digging troughs, and devoting
many hours a week...
3. Creating a garden is more than just planting seeds... as it requires building a border, fertilizing soll, digging troughs, and devoting
many hours a week.
4.
Creating a garden is more than just planting seeds as it requires building a border, fertilizing soll, digging troughs, and devoting
many hours a week.

Answers

Answer:

2

Explanation:

1 is broken off incorrectly, same with 3, 4 doesn't use ellipsis at all. (...) Logically, it must be 2.

Which BEST describes how stage direction contribute to the meaning of a play's script and play's performance
A) only the performers of a play need stage directions to help with the play’s meaning
B) only the readers of a play’s script need stage directions to help with the play’s meaning
C) only the audience members of you play need stage directions to help with the play’s meaning
D)The audience, performers, and readers of a play need stage directions to help with the play’s meaning

Answers

Answer:

D

Explanation:

Stage directions describe the actions during a play or musical. They benefit performs so they know what they're doing, they help readers visualize the story, and help audience members get a better glispe into the story.

The best way to explain how stage direction affects the meaning of a play's script and performance is to say that the audience, performers, and readers of a play need stage directions to help with the play’s meaning, as in Option D.

What is the significance of the stage direction in a play?

It is important for the play as the direction is helpful for the proper showcase of the emotions, movements, and dialogue by the characters. it is not only helps establish the setting and atmosphere of the play and directs the performers, but it also provides proper choreography and movement as per the environment.

Hence, the best way to explain how stage direction affects the meaning of a play's script and performance is to say that the audience, performers, and readers of a play need stage directions to help with the play’s meaning, as in Option D.

Learn more about the stage direction of a play here.

https://brainly.com/question/30122609

#SPJ5

Is it easy to hold an opinion that is not the majority?

Answers

Nah but you gotta hold your own

HELP ASAP
Which of the following best describes the
appearance of Hester Prynne?
O shameful and withdrawn
O grim and grisly
O graceful and transfigured
O pitiless and judgmental

Answers

Answer:

C: graceful and transfigured

Explanation:

The language Hawthorne uses to describe her contrasts sharply with the language to describe the rest of the scene.

Answer: The answer is C. Graceful and transfigured

Explanation: I just answered it on Edg. it is correct good luck

Other Questions
3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change? can you plzzzzzzzzzzzz help me