Ano ang pakay nina Don Tiburcio at Donya Victorina sa tahanan nila Kapitan Tiago​

Answers

Answer 1
A Filipina woman married to Don Tiburcio. Above all else, Doña Victorina cares about her image as a beautiful and admired socialite, though she is actually—as Rizal goes out of his way to emphasize—past her prime. She is only in her thirties but looks much older, and she quickly adopts the latest trends, often changing her patterns of speech to reflect the sound of high society members. It is her idea to have Don Tiburcio treat María Clara. She also encourages him to bring along his respectable nephew Linares, whom she is eager to pair off with María Clara when Captain Tiago—whose advances she denied as a young woman because he was Filipino and not Spanish—calls off the wedding between his daughter and Ibarra.
La Doctora Victorina de los Reyes de Espadaña Quotes in Noli Me Tangere

The Noli Me Tangere quotes below are all either spoken by La Doctora Victorina de los Reyes de Espadaña or refer to La Doctora Victorina de los Reyes de Espadaña. For each quote, you can also see the other characters and themes related to it (each theme is indicated by its own dot and icon, like this one: Colonialism, Religion, and Power Theme Icon ). Note: all page numbers and citation info for the quotes below refer to the Penguin Books edition of Noli Me Tangere published in 2006.

Related Questions

Please hurry, ill like it or sum

Answers

Answer:

nadamos

Explanation:

to swim= nadar

nosotros is we

nosotros nadamos is we swim

Complete each sentence with a form of the verb "ir".
1. Tú_____
a la escuela todos los días.
2. Elena y yo nunca____
a la oficina del director.
3. Los estudiantes_____
al gimnasio para correr.
4. Usted________
a casa a las 4:00 de la tarde.
5. Yo_______
a la clase de español.
How to say to the in Spanish:

Answers

Answer:

1. vas

2. vamos

3. van

4. va

5. voy

Explanation:

El sonido ch se representa con dos letras, lo mismo que el sonido.

Answers

Answer:

ll

Explanation:

El sonido con doble L:

LL

o

ll

por ejemplo:

llaves

ollas

llanta

calle

5.1- Un joven se detuvo a mi lado sobre el césped. Tenía las mejillas tersas como de

pulido mármol, lucientes los ojos, el cabello con lozanía de almácigo. Me miró

sonriendo.

__Hermoso cielo ¿no le parece? __me dijo.

Josefina Plá.

___________________________________

5.2- ¡Pero qué zonzos son! Lo Reye no hay. Lo Reye son tu papá que te pone en tu

zapato mientra vó dormí…

Mario Halley Mora.

____________________________________

5.3- ¿Quién se ha…reído?

-No he sido yo, señor maestro-se apresuraban a contestar temblorosos los alumnos.

Ricardo Palma.

____________________________________

5.4- Para enlazar entre sí las oraciones simples, disponemos de los siguientes

procedimientos gramaticales: yuxtaposición, coordinación y subordinación.

AYUDAAA ​

Answers

Answer:

De las tres maneras se puede formar oraciones complejas a partir de oraciones simples.

Explanation:

Write any 5 amazing facts of jarawas?? write in points.​

Answers

•Jarawas have a shorter average height
•They usually wear jewelry and little to no clothing
•They have their own language
•They only count to ten
•They hunt and fish for food

Lee y escoge la opción con la palabra o palabras correctas para completar la frase. Read and choose the option with the correct word or words to complete the sentence.

La palabra que describe convertirse en dueño de las tierras o los bienes de otras personas de una manera violenta o por la fuerza es ________. (1 point)
-defender
-apoderarse
-obligarse
-vigilar

Answers

The answer is Apoderarse
La respuesta Es apoderarse

i need help with this

Answers

Nuestra abuela
Su hermano
Mi padre
Tu Pedro
nuestra abuela
su hermano
mi padre
tu pero

-Fill in the blank.
Complete the sentence using the correct forms of ser or estar

¿De quién es el carro? ______ de Paco.

Answers

The answer is: es
Es de Paco

CAN SOMONE HELP ME ON 7,8,12,14 PLEASE WILL GIVE BRAINLIEST XOpt
7. Los chicos son trabajadoros
(trabajador).
XOpt
8. Mis amigas son pacientamos
(paciente).
1pt
9. El bistec es mi favorito
(favorito).
1pt
desordenado
10. Mi amigo es muy
(desordenado)
Ipt
11. El pastel y el helado son deliciosos
(delicioso)
X XOpt
12. Juan y Miguel son muy deportistamos
(deportista).
1pt
13. La profesora de matemáticas es inteligente
inteligente).
x Opt
14. Las papas fritas son mal
(malo) para la salud.

Answers

Answer:
7. trabajadores
8. pacientes
12. deportistas
14. malas

Explanation: I hope this helps you :)

Which of the following words means "chore"?.
O A. El quehacer
O B. El estante
O C. El sillón
D. El dormitorio

Answers

Answer:El quehacer

quehacer translates to “do” which is like doing a chore

Explanation:

Answer:

A. El quehacer

Explanation:

Which word best completes this conversation?

Juan: ¿Cuándo entregaste la tarea para la clase de biología?
Eric: Ayer _____ la tarea.

A.
entrego
B.
entregué
C.
entrega
D.
entregó

Answers

Answer:

B entregué.....................

B.entregue
Hope this helps you!

Listen as senora Jimenez talks about a party she has planned. Then answer the questions below? I don’t know the answers to it and it’s hard to listen to what she’s saying

Answers

Answer:

Is their an audio?

Explanation:

.........

Which is the best way to say the following in Spanish: Tomato Soup



Sopa de tomate

Tomate sopa

Sopa Tomate

Tomate de sopa

Answers

It would be ‘Sopa de tomate’

Answer:

Sopa de tomate

Explanation:

Please help me don’t put the random link or don’t scam me

Answers

Answer:

gave you a photo

Explanation:

I hope it helps!

Change the sentence from singular to plural.
El cuaderno es verde.

Answers

Answer:

Los cuaderno son verde.

Explanation:

Answer:

Los cuaderno son verde

Explanation:

-Fill in the blank.
Complete the sentence using the correct forms of Ser or Estar

1.) Mi amiga Ana __ de Costa Rica. Ella ___ costarricense.

Answers

Answer:

1.es

2.es

Explanation:

Need help ASAP with 1-3

Answers

I already answer this question
Explanation:

Read the description and choose the option with the correct answer.
Omar is an architect and artist who is very interested in Antoni Gaudí. What could he
write in his blog after his trip to Spain?
Pasé dos días en el museo del Prado.
Viajé por La Ruta de Don Quijote.
Visité la Sagrada Familia.
Compré un crucero por el Atlántico.

Answers

Answer: pase dos días en el museo del Prado

Explanation: because Omar is an architect and artist (museo means museums)
The answer is option 1

Complete the following conversation with the correct form of the verb in parentheses. (ANSWER IN ORDER FROM 1-10)
Todos lo dias yo _______(ir) a la esciela con mis amigos. Nosotros _______(llegar) a la escuela a las ocho. A las ocho y cuarto yo _______(tener) la clase de inglés. La clase de inglés _______(estar) al lado de le cafetería. En clases el maestro siempre _______(hablar) mucho. Todos los estudiantes _______(tomar) apuntes porque la clase es difícil. Después de la clase nosotros _______(tener) la clase de matemáticas. Nosotros _______(tener) que llegar temprano porque cuando tú _______(llegar) tarde el maestro no _______(estar) contento.

Answers

1. Voy
2. Llegamos
3. Tengo
4. Está
5. Habla
6. Toman
7. Tenemos
8. Tenemos
9. Llegas
10. Está

Question 10 of 20
Fill in the blank with the most appropriate verb.
Cuando el bebé
yo me acosté.
A. te dormías
B. dormido
C. se durmió
O D. duerme

Answers

Answer:  C  se durmió

Explanation:

Cuando el bebé  se durmió yo me acosté.

C. se durmió

Correctamente se diría “cuándo el bebé se durmió yo me acosté” :)

Oraciones con la palabra vicioso
POR FAVORR AYUDA ES PARA HOY​

Answers

Cuantas en específico o las que sea

Which two countries have the similar land mass?

DO NOT PROVIDE LINKS SAYING HERE IS THE ANSWER cause I know you do this for points without answering and if you do this I will report you. (Whoever answers will get brainlist!)

Answers

Answer:

Russia and Canada

Explanation:

Change the sentence from singular to plural.

El lapiz es amarillo

Answers

Answer:

Los lápices son amarillo

Explanation:

“Los lápices son amarillos.” Thats the correct answer.

Please help me with this assignment, don’t put that link
Tell me if you need any of my vocabulary sheet words

Answers

Answer:

en general ellos hablaban de ir a ver una película de terror en el cine.

Explanation:

in general they were talking about going to see a horror movie in the movie theater. ( that's what the answer says )

explica cómo se revela el talento de bill gate con respecto al uso de los ordenadores personales o PC

Ayuda por favor ​

Answers

Answer:

Bill Gates es un programador, empresario, fundador de Microsoft Corporation y filántropo Americano. En su primer año de estudios, Gates dejó la Universidad de Harvard y dedicó todas sus energías a Microsoft, empresa que fundó en 1975 con su amigo de la infancia Paul Allen. Firmemente convencidos de que la computadora sería una herramienta valiosa en todas las oficinas y hogares, comenzaron a desarrollar software para computadoras personales. La visión masiva de Gates para las computadoras personales ha sido una de las principales causas de Microsoft y la industria del software: a partir de la masificación de esta industria, la computadora se convirtió en un artefacto de uso cotidiano para millones de personas.  

Question 16 of 20
Fill in the blank with the appropriate preterite form of the verb hacer,
Maite, ¿qué
tú anoche?
A. hacías
B. hiciste
C. hace
D. hizo
SUBMIT

Answers

The correct answer is b. Hiciste

What do you do in these situations? Choose the sentence that is the best remedy.

Modelo: sentirse débil >> Si me siento débil, descanso y como bien.



What would be the best remedy for...

doler la cabeza >>

Your answer:

Sí me duele la cabeza, tomo medicamentos.


Sí me duele la cabeza, voy a una fiesta.


Sí me duele la cabeza, juego videojuegos.




2. What would you say to the characters in these situations? Choose the best answer in the command form that includes a reflexive or direct object pronoun.

Modelo: Andy tiene un examen a las 9 de la mañana >> ¡Levántate!

Remember to follow all directions.

Mack tiene un correo electrónico de la madre de Tim. >>

Your answer:

¡Léelo!


¡Leela!


Lee

Answers

Answer:para el dolor de cabeza tomar acetaminofen.2 leelo!

Explanation:

Deja tus gracias porfa

Is this right?????????

Answers

It’s the second luv:)

Read and select the best answer to complete the dialogue.
How does she reply after the question?
--¿Cómo te llamas?
Rosa.
O Encantada
O Igualmente
O Mi nombre es
O Tú eres

Answers

She replies with “Mi nombre es”

Answer:

O Mi nombre es

Explanation:

Mariana and her friend Francisca are talking after class. Read the dialogue below, and fill in the blanks with the appropriate preterite tense conjugations of the verbs in the parentheses. Pay special attention to the reflexive verbs.
Carolina: Oye, Francisca, ¿por qué no _______________ (ir) a la fiesta en casa de Pepe anoche? *
Francisca: Yo _______________ (tener) que trabajar en la tienda de mi tío hasta muy tarde... *
Francisca (con´t):... porque a última hora, la dependiente no _________________(venir). *
Francisca (con´t): Ayer necesitaron mi ayuda, porque _______________(haber) una gran liquidación en zapatos de verano. *
Carolina: ¡Pobrecita! La fiesta _______________(ser) muy divertida, y tú no ________________________ (estar)! *
Estructura 2: Simplifying expressions with Direct Object pronouns
Fill in the blanks with the correct direct object pronoun
¿Compraste los calcetines verdes de lana? Sí, ______________ compré. *
A. lo B. la C. los D. las
Petra, ¿vas a mandar las pulseras por correo? No, no ______________ voy a mandar. *
A. lo B. la C. los D. las
¿Ya hiciste la tarea? Sí, ______________ hice anoche. *
A. lo B. la C. los D. las
¿Trajo el paraguas hoy, Señor Benavente? Sí, claro que ______________ traje. *
A. lo B. la C. los D. las
¡Hubo un accidente terrible en la carretera! ¿No __________________ viste? *
A. lo B. la C. los D. las
Estructura 3: Describing ongoing and habitual actions in the past: The IMPERFECT TENSE
Fill in the blanks with the correct imperfect tense forms of the verbs in parentheses.
Cuando yo ________________(ser) niño, siempre _________________(pensar) que la luna era de queso. *
Mi primo, que _______________(ser) mayor que yo, me ___________(decir) que un ratón (mouse) grande la puso allí en el cielo. *
La luna _______________________(estar) tan alta que los otros ratones no la __________________ (poder) alcanzar (to reach). *
Cada noche, cuando me _____________ (ir) a dormir, me _________________(quedar) mirando la luna y pensando cómo iban a llegar los otros ratones que _______________(querer) robarla.

Answers

Answer:

Explanation:

Carolina: Oye, Francisca, ¿por qué no _____fuiste__________ (ir) a la fiesta en casa de Pepe anoche? *

Francisca: Yo ______tuve_________ (tener) que trabajar en la tienda de mi tío hasta muy tarde... *

Francisca (con´t):... porque a última hora, la dependiente no ______vino___________(venir). *

Francisca (con´t): Ayer necesitaron mi ayuda, porque ______había_____(haber) una gran liquidación en zapatos de verano. *

Carolina: ¡Pobrecita! La fiesta ____estuvo___________(ser) muy divertida, y tú no ________estuviste________________ (estar)! *

Estructura 2: Simplifying expressions with Direct Object pronouns

Fill in the blanks with the correct direct object pronoun

¿Compraste los calcetines verdes de lana? Sí, ______los_____ compré. *

A. lo B. la C. los D. las

Petra, ¿vas a mandar las pulseras por correo? No, no _____las______ voy a mandar. *

A. lo B. la C. los D. las

¿Ya hiciste la tarea? Sí, ______la________ hice anoche. *

A. lo B. la C. los D. las

¿Trajo el paraguas hoy, Señor Benavente? Sí, claro que _____lo______ traje. *

A. lo B. la C. los D. las

¡Hubo un accidente terrible en la carretera! ¿No ______lo_____ viste? *

A. lo B. la C. los D. las

Estructura 3: Describing ongoing and habitual actions in the past: The IMPERFECT TENSE

Fill in the blanks with the correct imperfect tense forms of the verbs in parentheses.

Cuando yo _____era___________(ser) niño, siempre _____pensaba____________(pensar) que la luna era de queso. *

Mi primo, que _____era__________(ser) mayor que yo, me ___decía___(decir) que un ratón (mouse) grande la puso allí en el cielo. *

La luna ______estaba__________(estar) tan alta que los otros ratones no la _____podián_____________ (poder) alcanzar (to reach). *

Cada noche, cuando me _____iba______ (ir) a dormir, me _____quedaba_______(quedar) mirando la luna y pensando cómo iban a llegar los otros ratones que _____querían_______(querer) robarla.

Other Questions
In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals. Why is it important for the brain to be so well protected? Bryson is painting kitchen stools. Each stool requires 1 1/2 liters of paint. Bryson has 20 liters of paint, How many stool will he be able to paint? En France, on sert toujours une salade verte au dbut d'un repas.TrueFalseNEXT QUESTIONASV COR irin How are ionic compounds named? What is the volume of the square pyramid ? Why didnt the Renaissance happen sooner? Fill in the blanks in the following sentences using the cues in parentheses.Remember to include the appropriate definite or indefinite articles where necessary.6. J'ai besoin d'____pour ce voyage. (airline ticket)7. Prends-tu ___pour aller Londres? (umbrella) What is depicted in the image below?