would you expect a plant to produce more oxygen on a cloudy day or a sunny day? explain

Answers

Answer 1

Answer:

You would expect a plant to produce more oxygen on a sunny day because there are more sun rays available to plants so photosynthesis is easier to maintain, as well as oxygen production.


Related Questions

please help ::( i wanna pass w good grades

Answers

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

What are the two resulting cells formed from single cell called

Answers

"Daughter cells" is the correct answerThe cell that splits is called the "parent cell" and the two cells that form are called the "daughter cells".Please let me know if I am wrong.

What layer of the Earth does the upper surface of the cross-section represent? Group of answer choices Inner Core Outer Core Mantle Crust

Answers

Answer:

Hello! Your answer is...

The lithosphere is the rocky outer part of the Earth. It is made up of the brittle crust and the top part of the upper mantle. The lithosphere is the coolest and most rigid part of the Earth. The crust is the layer that you live in. The Outer and Inner Cores are hotter. The temperatures of the crust vary from air temperature on top to about 1600. The asthenosphere is the part of the mantle that flows and moves the plates of the Earth.

Explanation:

Hope this helps you! I'm new, but am really smart and nice. Hope you enjoy your time on brainly!

The crust of the Earth, the uppermost layer visible in a cross-section of the planet, is halfway through at this point. The crust, which only accounts for around 1% of the Earth's total volume, is made up of igneous, metamorphic, and sedimentary rocks.

What is the upper surface of the cross-section of Earth?

The rocky exterior of the Earth is known as the lithosphere. It is composed of the uppermost layer of the upper mantle and the brittle crust. You live in the crust of the earth. It is hotter in the outer and inner cores.

The crust varies in temperature from the top air temperature to roughly 1600. The Earth's tectonic plates are moved by the asthenosphere, a region of the mantle.

Therefore, Mantle Crust layer of the Earth does the upper surface of the cross-section represent.

Learn more about Earth here:

https://brainly.com/question/14491367

#SPJ2

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

Which kind of worm is sometimes used to prevent blood clots?

planarian
leech
fluke
hookworm

Answers

Answer:

Leech

Explanation:

leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.

Answer:

a leech i got it correct on edu!

Explanation:

the question are in the Picture:) Please help me :) ​

Answers

Answer:

Birds

Explanation:

1. Wings

2. Flight feathers and beak

3. For survival purposes

what would the chromosome to the right be called?

Answers

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

The coronavirus attaches to a membrane protein called

Answers

Answer:

M glycoprotein..

The coronavirus attaches to a membrane protein called M glycoprotein..

What is the purpose of cellular respiration. In a short sentence

Answers

Answer:

Produce energy (in the form of ATP) for metabolic processes and muscle contraction.

Explanation:

At the zoo, Anya observes that individuals of a certain kangaroo species have slightly different sizes and colors. What characteristic of populations is Anya observing?

O adaptation
O evolution
O selection
O variation

Answers

The answer is variation, because the same species can vary in color and sizes

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

PLZ HELP I"LL GIVE BRAINLIEST

Answers

Answer:

gotchu

Explanation:

1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)

2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal

b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster

3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.

4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women

5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD

6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids

What are the potential advantages and disadvantages of a major shift from the hard or traditional path of energy development to the soft or visionary path?

(These were the corresponding textbook pages, if needed) Please read the following from the textbook Environmental Science:
7th Edition - Chapter 17
9th Edition - Chapter 14

Answers

Answer:

Advantages of following the soft path, the argument here is alternative sources of power such as hydropower, geothermal energy , wind energy , and photovoltaic cells must be developed. This provides a alternative source to remain in a healthy environment and also function as the society we currently live in using the hard path.  Disadvantages of following the hard path result with future generations fearing over the irreversible damage of climate change and the damage done to our atmosphere. The hard path argue that we should continue to operate in the future as we have in the past, except more efficiently. This is close to impossible and will only continue the negative effects the hard path( the path we have been following) results in. The major shift determines the outcome of this world, the futures worries or reliefs and ultimately the survival of humans.

Explanation:

the ___severs as a relay station between the hindbrain and the forebrain.
A. forebrain

B. Midbrain

C.cerebral cortex

D. hindbrain

Answers

Answer:

B. Midbrain

Explanation:

I'm pretty sure this is it.

the answer is the midbrain cuz u can cross of forebrain and hindbrain and the cerebral cortex doesn’t apply so it’s B

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.

The weight of the man will...
Explanation...

Answers

Answer:

Increases.

Explanation:

A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.


True or False.
A group of the same species of living things in an area is a population

Answers

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

why do people like sparkling water?

Answers

Answer:

maybe they think it will make them magical?

Explanation:

What do coal deposits tell you about the continents?

Answers

Answer:

Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.

Which of the following are prokaryotic cells?

A) plants

B) fungi

C) bacteria

D) animals

E) B and C only

Answers

fungi, bacteria

If I remember right, eukaryotic means there's more than one, so I believe this answer is right

The Answer is c: bacteria

Hey My Name is Chloe, and I need some Help, But if you can't it's ok,

So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine

Answers

Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.

Explanation:

Answer: Animal: Bengal tigers

Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world?  Are bengal tigers being bred in captivity.

Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.

Explanation: I would suggest looking at national geographic if you want cooler animals.

What is the definition for polyploidy?

Answers

containing more than two homologous sets of chromosomes.

7._________________________ lines your digestive tract and blood vessels. It moves food and blood through your body.

smooth muscle
skeletal muscle
cardiac muscle

Answers

Answer:

Smooth Muscle

Explanation:

In the digestive tract it's called the muscularis mucosa.

How do antibiotics work? Note: you will not be given credit for simply stating “they prevent bacterial growth” or “they kill bacteria”

Answers

Antibiotics stop infections caused by bacteria, they kill it , and/or keep them from copying themselves or reproducing . antibiotic means against life, so any drugs in your body is technically an antibiotic. they attack the wall or coating surrounding the bacteria

Answer:

here's your answer

Explanation:

May this helps you..

Each of the following is a density-dependent limiting factor EXCEPT:

- crowding
- predation
- competition
- disease

Answers

Answer:

predation

Explanation:

predation

I hop this answer is correct

Answer:

Disease

Explanation:

PLZZ HELP IM DOING A UNIT ASSESMENT!!!!
What types of cells would contain cell walls and what types of cells would contain a cell membrane?

Answers

They have walls plants have walls

Answer:

I agree with the other person

have a good day :)

Explanation:

A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).

Answers

Answer:

The allelic frequency for pointed ears is 0.5 (50%).

Explanation:

The frequency of alleles in a population must add up to 1 (100%).

The allelic frequency for pointed ears is 0.5 (50%).

What is allelic frequency ?

The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.

What is the difference between gene frequency and allele frequency?

Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.

To learn more about allelic frequency , here

https://brainly.com/question/23362399?referrer=searchResults

#SPJ2

The North Pole and the South Pole are

A:Classified as tundra biomes

B: Not home to any animals

C: not classified into major biomes.

D: Part of Aquatic Ecosystems​

Answers

D part of aquatic ecosystems

Answer:

A

Explanation:

classified as tundra biomes

What is a simple diffusion?

Answers

Answer:

movement of a solute from an area of high concentration to an area of low concentration

Explanation:

Other Questions
Bir saynn 2 bl 5 'sinin 3 eksii, bu saynn eyreine eittir.Buna gre bu say katr? What 5 divided by 4.25. Scientists are conducting an experiment with a gas in a sealed container. The mass of the gas is measured, and the scientists realize that the gas is leaking over time in a linear way. Its mass is leaking by 9.7 grams per minute. Eight minutes since the experiment started, the remaining gas had a mass of 339.5 grams. Let x be the number of minutes that have passed since the experiment started, and let y be the mass of the gas in grams at that moment. Use a linear equation to model the weight of the gas over time. a. This line's slope-intercept equation is ___________b. 31 minutes after the experiment started, there would be ____________ grams of gas left. c. If a linear model continues to be accurate,______________ minutes since the experiment started, all gas in the container will be gone. what value is equivalent to After Tacomas population exploded in the 1870s, it became a major center forshipping and railroads.mining and logging.trade and manufacturing.agriculture and industry. Reread this sentence from the story. "When we've converted you to a proper point of view, we may quit." In your own words, what does, "When we've converted you to a proper point of view" mean. Help please looks at the photos HURRY PLEASE. 90 POINTS!! Find (8). 18, 8, 0, 8 Question 2 (1 point) The object of a sentence is the ____ receiving the ____.Question 2 options:verb, nounantecedent, prounounnoun, verbsubject, object Pls help! Question: What does this poem mean to you?Hold the door,say pleaseSay thank you,Don't steal,Don't cheatDon't lie,I know you've got mountains to climbBut always stay humble and kind! did anyone listen to the podcast name finding Cleo? Fionn observed that 91\%91%91, percent of the background checks he processes are for potential employees who have already interviewed. Let BBB be the number of background checks Fionn processes to get his first background check for a potential employee who has not yet interviewed for the job. Assume that the interview statuses are independent. Find the probability that the 8^{\text{th}}8 th 8, start superscript, start text, t, h, end text, end superscript background check that Fionn processes is the first for which the potential employee has not yet interviewed. Sara wants to revise this sentence to use formal language. Which sentence is the best revision?When Enrique sees his reflection in a store window, he gets that he's a grown up.Enrique examines his reflection in the store window and realizes that he is no longer a child.When Enrique catches his reflection in a store window, he realizes he's totally not a kid anymore.Enrique sees his reflection in the store window and realizes that he needs to leave that kid stuff behind Solve 81^x= 27^x + 2 find the volume and the total surface area of a cube whose edge is 1.5m. Which expression is represented by the model below?2 bars are shown next to each other and each bar is labeled A. 823 B. 328 C. 832 D. 238 To what extent were the lives of African-Americans changed during the 1950's? As atmospheric CO2 increases, the amount of CO2 dissolved in seawater is expected to increase as well. This produces more carbonic acid, which then dissociates into hydrogen ions and something else. For the sentence-Tu finis le chocolat. Pass compos. how do I turn that into pass compos how did industrialization and immigrations change cities?