Why is the moon abiotic?

Answers

Answer 1
The moon is abiotic because it is a non living thing
Answer 2

Answer:

The moon is abiotic because it doesnt move and it's not a living thing.


Related Questions

There is the picture to the question

Answers

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

Drag the tiles to the correct boxes to complete the pairs.
Match the mRNA sequences to their DNA sequences.

Answers

1.) UUUUUAACG
2.) CCGAAAUGU
3.) AUUACGCAU
4.) GAUCAUUAC

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

What is true about the insanity defense?

It is defined in the Diagnostic and Statistical Manual of Mental Disorders.
It can be used only if a person is diagnosed with a specific disorder from the DSM.
It is a legal term used to determine if a person can be held accountable for a crime.
It is a legal term that helps to determine if a person committed a crime or not.
It cannot be used if a person was previously found to be responsible for a different crime.

Answers

It is a legal term used to determine if a person can be held accountable for a crime

It's a legal term used to determine if a person can be held accountable for a crime. Hope this helps; have a wonderful day.

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

A dichotomouys key is used to identify a plant. 1a. Leaves are spiny ......................Pinus taeda 1b. Leaves are broad..................... Go to 2 2a. Single leaf..........................Go to 3 2b. Many leaves....................... Go to 4 3a. Leaf edge is smooth..............Cornus florida 3b. Lead edge is rough...............Ulmus americana 4a. Leaflet edges are smooth........Albizia julibrissin 4b. Leaflet edges are rough.........Juglans nigra A plant has many broad leaves with rough edges. What type of plant is this? (1 point)

albizia julibrissin
pinus taeda
cornus florida
juglans nigra

Answers

Answer:

juglans nigra

Explanation:

I did my research and its correct I finished the quiz

1 B

2 C

3 D

4 C

5 A

The plant identified by the dichotomous key is juglans nigra.

What is a dichotomous key?

A dichotomous key is a tool used to identify any plants and animals in the ecosystem.

They are identified by their morphological traits.

The key is made up of a set of paired assertions or clues about the qualities or attributes of the organisms.

It serves as a step-by-step guide to identifying each object.

Thus, the correct option is D, juglans nigra.

Learn more about the dichotomous key, here:

https://brainly.com/question/25244481

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

7. Which of the following is not an example of an abiotic factor?
O Water
O Soil
O Disease
O Air
Please help

Answers

Answer:

Disease

Explanation:

Water, Soil and Air are all biotic except for disease.

Yes that’s right absolutely

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

Which amino acids are coded for from the DNA sequence TACCAGCCA?
methionine, valine, and glycine


methionine, glutamine, and alanine


methionine, valine, and aspartic acid


arginine, histidine, and cysteine
Where do the instructions for building a protein originally come from?
tRNA


rRNA


DNA


mRNA
A _______________ is composed of a series of amino acids.
Molecule


Protein


Nucleotide


Cell

Answers

Explanation:

DNA

The instructions for building a protein originally come from DNA, which is the store for all hereditary information.

A protein is composed of a series of amino acid.

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

The Milky Way galaxy was given its name because of what it looks like when viewed from Earth.
True False

Answers

Answer:

false. we cant see the whole galaxy from earth.

Answer:

the answer is false

Explanation:

we can't see the milky way (galaxy) from earth, its impossible since its so far away. unless we used a telescope maybe, not sure but for this question its false. I hope this helped!

☁️☁️☁️☁️☁️☁️☁️

the frequency of a wave in a stretched string depends on the length L, tension T and linear density m with dimension ML-1 . deduce the formula for f in terms of L , T and M using dimensional analysis​

Answers

Answer:

[tex]f = \frac{1 }{L}\sqrt{\frac{T}{m} }[/tex]

Explanation:

Let the frequency ,

[tex]f = L^{x}T^{y}m^{z}[/tex]

Now the unit of frequency is hertz = s⁻¹ = T⁻¹ where T is time, tension T = kgm/s² = MLT⁻¹ and linear density m = kg/m = ML⁻¹.

So,

[tex]T^{-1} = L^{x}[MLT^{-2} ]^{y}[ML^{-1} ]^{z}\\[/tex]

collecting the like bases, we have

[tex]T^{-1} = [L^{x + y -z}][M^{y + z} ][T^{-2y} ] \\L^{0} M^{0} T^{-1} = [L^{x + y -z}][M^{y + z} ][T^{-2y} ][/tex]

Equating powers on both sides, we have

x + y - z = 0  (1)

y + z = 0       (2)

-2y = -1         (3)

From (3), y = 1/2

From (2), z = -y = -1/2

Substituting y and z into (1), we have

x + y - z = 0

x + 1/2 - (-1/2) = 0

x + 1/2 + 1/2 = 0

x + 1 = 0

x = -1

So,

[tex]f = L^{x}T^{y}m^{z}\\f = L^{-1}T^{\frac{1}{2} }m^{\frac{-1}{2} }[/tex]

[tex]f = \frac{1 }{L}\sqrt{\frac{T}{m} }[/tex]

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

Answer fast please. !!!!!!!!!!!!!!!!!!A geologist who needs to curricula to rock formations in different areas can match exposed rock layers
true or false

Answers

Answer:

A geologist who needed to correlate two rock formations in different areas could match exposed rock layers? A geologist who needed to correlate two rock formations in different areas could match exposed rock layers. TRUE.Explanation:

Answer:

true

Explanation:

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

HELP ASAP PLS IF U ANSWER U GET 40 POINTS THANKS

Answers

Explanation:

The grass help feeds the baboon. This means the baboon will have to poop out the grass. Then the dung bettle feeds off of that poop.

what are the pros and cons of online school​

Answers

Answer:

The Pros and Cons of Studying Online

Pro: Increased Flexibility. The biggest advantage to studying online is the increase in flexibility. ...

Con: Reputation. Many firms and institutions are quick to dismiss an online education. ...

Pro: Ease of Access. ...

Con: Lack of Social Interaction. ...

Pro: More Affordable. ...

Con: Fewer Courses.

Pros of Online Schools:

Time flexibility.

Availability.

24/7 access to course material..

Location flexibility.

Zero commute.

Self-Direction.

Multi-media presentations.

Variety of course options.

Cons of Online Schools:

Limited interaction with instructor.

Technology requirements.

Social interaction.

Campus environment.

Time management.

Stigma.

Credit transfer.

Financial aid.

Have a wonderful day!

What happens during the pathway of glycolysis?

A. Glucose is broken down into private

B. Carbon dioxide is produced

C. More ATP is consumed than is produced.

D. Lactic acid is produced

Answers

Answer:

the correct answer is A :Glucose is broken down into pyruvate

Answer:

If I'm correct, the glucose is broken down into pyruvate and energy.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️

What does the brain stem do?

Answers

Help you out with anything you’re having trouble with

Answer:

It connects the rest of the brain to the spinal cord, which runs down your neck and back. The brain stem is in charge of all the functions your body needs to stay alive, like breathing air, digesting food, and circulating blood.

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Please help due in 10 minutes!
Explain how genetic drift of alleles in a small population- and- describe 2 real world examples of genetic drift (I.e. The Founder Effect and The Bottleneck Effect)

Answers

Answer:A small population is formed with a larger population.

Explanation:The population don’t represent the genetic diversity’s of the original

Population, and there smaller size mean they may experience strong drift of generations.

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

Neurons that respond to specific types of lines are examples of:
A. figure detectors.
B. top-down processors.
C. feature detectors.
D. figure processors.

Answers

Answer:

C

Explanation:

Neurons that respond to certain types of lines are examples of feature detectors found in Option C. Neurons are the monomeric units of the nervous system that play an important role in transmission.

   

What is the importance of the neuron?

The neuron is a unit in which the message is transmitted from the neuron to another neuron, and this can be done by either chemical signaling or by electric signaling. The neuron receives sensory stimuli from the sensory organ and transmits them to the spinal cord.

Later, the message from the spinal cord is sent to the motor organs, and the whole pathway of the neuron signaling from the sensory to the motor organ is called the reflex arc. The neuron takes part in the signaling process so that the muscle can function, regulate the contraction relaxation, and perform many other functions.

Hence, neurons that respond to certain types of lines are examples of feature detectors found in Option C.

Learn more about the neuron here.

https://brainly.com/question/29462317

#SPJ5

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

Other Questions
In 1880 five aboriginal trackers were each promised the equivalent of 100 Australian dollars for helping to capture the notorious outlaw Ned Kelley. In 2002 the granddaughters of two of the trackers claimed that this reward had not been paid. The Victorian prime minister stated that if this was true, the government would be happy to pay the $100. However, the granddaughters also claimed that they were entitled to compound interest.Required:a. How much was each granddaughter entitled to if the interest rate was 4%? b. How much was each entitled to if the interest rate was 8%? In prokaryotes, certain proteins act to regulate genes by binding to DNA. What could be the effect of these binding proteins? Ummm HELPSSSThanks and Im very welcomed:) Read this excerpt from Chapter 8 of Lord of the Flies.Simons head was tilted slightly up. His eyes could not break away and the Lord of the Flies hung in space before him."What are you doing out here all alone? Arent you afraid of me?"Simon shook."There isnt anyone to help you. Only me. And Im the Beast."Simons mouth labored, brought forth audible words."Pigs head on a stick."What does author William Golding allude to by naming the pig's head the Lord of the Flies? He references the devil as he appears in the Bible's Old Testament.He references song lyrics in which a fly is trapped in a jar.He references a children's story in which a fly forgets its name.He references a short story in which a man awakens to find he has been transformed into a fly. Difference between a port and a connector 9. Henry joined an art class that charges$125 for the cost of supplies, plus $25per class. Henry wants to spend no morethan $500 on art classes. Whichinequality can be solved to find thenumber of classes Henry can take?A 25x + 125 < 500B 125x - 25 > 500C 25x 2 625D 125x + 25 S 500 Find 2 ways that natural gas forms. List the steps of the two carbon pathways below. Label each location with A for atmosphere, B for the biosphere, G for geosphere, or H for hydrosphere. Use P for the anthroposphere. Em cada caixote cabem 30 dzias de laranjas. Um caminho est carregado com 80 caixotes de laranjas. Quantas laranjas, no total o caminho est carregando? the question is on the picture convert 5.70 lbs to grams and explain please help Read the poem.A Poison Treeby William BlakeI was angry with my friend:I told my wrath, my wrath did end.I was angry with my foe:I told it not, my wrath did grow.And I watered it in fearsNight and morning with my tears,And I sunned it with smilesAnd with soft deceitful wiles.And it grew both day and night,Till it bore an apple bright,And my foe beheld it shine,And he knew that it was mine,And into my garden stoleWhen the night had veiled the pole;In the morning, glad, I seeMy foe outstretched beneath the tree.Read these lines from the second stanza from "A Poison Tree."And I sunned it with smilesAnd with soft deceitful wiles.What is the meaning of the figurative language in these lines? A. Being in the sunshine makes the speaker's wrath worse. B. The speaker's soft, deceitful wiles help to lessen his wrath. C. Smiling makes the speaker forget his wrath. D. The speaker covers up his wrath with lies and smiles. Jonathan had $40 in his bank account. He withdrew $12 and deposited $4. How much is in his bank account now? Internet Is Not a Substitute for Libraries Earlier, students could only scan libraries to research for their essays and reports. However, living in the age of the internet has made accessing information easier than ever. The internet as a source of information has enabled many students, researchers, professionals, and even teachers to effectively and quickly improve their work. But it is not the best source of research. People can write whatever they think or feel about a subject and publish it on the internet, which can be biased, inaccurate, and even insensitive. Libraries, on the other hand, only house selective and original resource materials that have been thoroughly researched and reviewed before being published. A major problem with the internet is that the information is uncatalogued and saturated with a lot more information than what is needed. For instance, a search engine will provide an ample amount of recent content regardless of how useful. Libraries have not only a proper classifying system to organize all the information but also a person to sort and filter that information. Still, many people argue that libraries are not ideal for research because they do not work around the clock, but the originality and many benefits of libraries are undeniable. Therefore, the internet, despite being an essential tool for modern life, should not be the only nof research for students to explore. 3 Select the correct answer. What claim does the author make about the resource materials available on the internet? A. The information is exclusive and provides an in-depth analysis of a topic. B. The information is unreliable because the internet lacks quality control. C. The information is unfiltered and provides a platform for opposing views and opinions. D. The information is instant because of how easy it is to upload information on the internet. can someone please help me y=5x+1 essay horror story 350 Adele rides her bike 28 miles in 3.5 hours. How far has Adele traveled on her bike if she rides for 8 hours? Direct democracy is a system in whichparticipate in government decisions directly.All Athenian citizens participated in government by voting in the. 1. What does H.I.P.P.O. stand for? Habitat destruction, Invasive species, pollution, population Increase andover populationover productionover useover exploitation Decision making is often a biased and flawed process. This activity is important because a person who can identify and be aware of their biases may be able to make better decisions for themselves and may be able to diagnose flawed decisions that affect their workplace.The goal of this exercise is to test your knowledge of the nine fundamental decision-making biases.Availability BiasRepresentativeness BiasSunk-Cost BiasAnchoring and Adjustment BiasConfirmation BiasOverconfidence BiasHindsight BiasFraming BiasEscalation of Commitment BiasFirst, hover over each name and read the scenario. Next, click and drag each name into the appropriate area in the chart to correspond with the decision-making bias its scenario best represents. Help please 3 |X-4| +1 = 19