Which reason best explains why dead specimens must be used with transmission electron microscopes?

A.) Electrons pass over the specimen.
B.) The lights that are used are harmful to the specimens.
C.) Specimens are placed in a vacuum.
D.) The image that is produced is two dimensional.

Answers

Answer 1

Answer:

C. Specimens are placed in a vacuum

Answer 2

Answer:

C. Specimens are placed in a vacuum

Explanation:

Since transmission electron microscopes must be used in a vacuum the specimen cannot be living. In a vacuum, there is no oxygen so nothing could survive it.


Related Questions

what is the major nitrogen nous waste in humans​

Answers

Explanation:

urea

SUMMARY. Two major nitrogenous waste products, urea and ammonium (NH4+), are produced in humans when proteins are oxidized, and in this manuscript their excretions are examined from two perspectives.

1. How does adaption help the animals?

Answers

Answer:

Explanation:

A sobrevivir

According to Jefferson, a government must _____.

A) hold free elections every four years
B) tax its citizens only with a valid reason for doing so
C) respect the rights of its citizens or risk being overthrown
D) provide security for its citizens in the form of a strong military

Answers

Answer:

C) respect the rights of its citizens or risk being overthrown

Explanation:

How do genetics (genetic predisposition) and the environment work together to cause substance abuse in individuals? What is the likely role of epigenetics in this process?

Answers

Answer: The drug abuse is influenced by the environment and exerts influence on the gene expressions.

Explanation:

The genetic make up of the person is decides, which genes will be expressed and develop a trait in an individual. But this genetic expression can be influenced by the environmental factors like food, exposure to sunlight, and others. This study which relate environment with the genetic make up is called epigenetics. No person is drug addict by birth but the consumption of drug can influence the genetic make up and traits in a abuser. So here, the environment is influencing the genetic basis of a abuser.

HELP PLEASE!!! please keep it short

According to the sliding filament theory what happens to the sacromere during a muscle contraction?​

Answers

Answer:

A muscle fiber will contract when myosin filaments pull actin filaments closer together and thus shortening sarcomeres within a fiber.

What is an apex predator?

a) A consumer eaten by no other species
b) A producer of the highest nutritional value
c) A consumer living at the top of a mountain
d) A consumer that eats more than one species

Answers

The answer is A because it is on top of the food chain
i believe it is A, since apex predators are at the top of the food chain! they have no natural predators.

What is RNA and list and explain the 3 different types of RNA.

Answers

Answer:

RNA is Ribonucleic acid

mRNA

rRNA

tRNA,

Explanation:

mRNA, or messenger RNA, that serve as temporary copies of the information found in DNA; rRNA, or ribosomal RNA, that serve as structural components of protein-making structures known as ribosomes; and finally, tRNA, or transfer RNA, that ferry amino acids to the ribosome to be assembled

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

Which of the following measurements is the most precise?
165mg
O 164.5mg
164.47mg

Answers

Answer:

164.47mg

Explanation:

Precise means the most accurate

PLS I need someone to upload a photo of the answer!

Answers

Answer:

See the file bellow

Explanation:

if someone can answer it without saying idk by november 2nd 2020 will be marked the brainliest! how does the nervous system work with the digestive system to make jump roping possible??please answer asap​

Answers

The autonomic nervous system controls the tone of the digestive tract. The brain controls drinking and feeding behavior. The brain controls muscles for eating and elimination. The digestive system sends sensory information to the brain.

1)What is it about the structure of ATP that contributes to its ability to act as an energy currency?
2)When a phosphate is transferred from ATP, it can phosphorylate another molecule. How could this assist in allowing a protein to transport molecules against their concentration gradient?

Answers

Answer/Exlanation:

1) ATP (adenosine triphosphate) can be hydrolyzed such that it loses a phosphate group to form ADP (adenosine diphodphate). This is called ATP hydrolysis. This property allows ATP to act as energy currency because ATP hydrolysis releases the energy stored in the high energy phosphate bond.

2) Transporting molecules against their concentration gradient requires energy. When ATP loses its phosphate group, it can phosphorylate another molecule. This converts the molecule into its active state, giving that molecule the energy to pass through against the concentration gradient.

1) The ability of the ATP compound structure to act as an energy currency has been explained in the answers.

2) The method used by ATP to allow protein transport molecules against their concentration gradient has been explained below.

1) ATP is an acronym that stands for Adenosine triphosphate. This compound called ATP is divided into three phosphate groups with phosphate bonds that possess very high energy. Now, when water is added to ATP, the phosphate bonds that possess high energy will be broken down thereby releasing energy and producing adenosine diphosphate (ADP).

2) We saw above that when ATP undergoes hydrolysis, the phosphate bonds are broken down to form ADP and releases energy. However, it can undergo further phosphorylation to form another molecule which becomes energized when it goes to a higher energy state.

Now, In this higher energy state it gets to, it will be observed that the protein will possess enough energy to transfer molecules against a concentration gradient that requires energy.

Read more at; https://brainly.com/question/18116896

what controls traits and inheritance

Answers

Answer:

In the explanation. :)

Explanation:

An organism's traits are controlled by the alleles it inherits from it's parents. Some alleles are dominant, while other alleles are recessive.

Hope this helps. Have a great day!

What are the genotypes of the F1 parent plants?

Answers

F1 Parent Plant 1 genotype: F1 Parent Plant 2 genotype: 2. First, consider the gametes that each parent plant can create.

Like nutrients and water, energy also recycles through an ecosystem,True Or False?​

Answers

Answer:

Explanation:

True

what structures found in the nucleus contain the genetic information of an organism

Answers

the nuclear envelope is a double membrane of the nucleus that encloses the genetic material it separates the contents of the nucleus from the cytoplasm the nuclear envelope is made of two lipid bilayers and membrane in an outer membrane

Explanation:

step-by-step explanation

A person who is optimistic:

O A. will make more money.
O B. believes that others control his or her fate. .
O C. will have successful relationships.
O D. will be healthier.

Answers

Answer:A

Explanation:

because optimistic people are confident about their future

Optimistic people believe that they will make more money. Therefore, option A is correct.

What is an optimistic person?

A person who is very confident and hopeful about his future and hopes for good outcomes is known as an optimistic person. They have faith in themselves and believe that they have the skills to make everything good. Optimists are happier than pessimists.

An optimistic person sees the positive side of everything. They believe their faith is in their own hands, and no one can control it. Their point of view is always positive. There are two types of optimistic people and that are comparative optimism and nihilistic optimism.

They believe that they will be successful and make more money in the future. Therefore, option A is correct.

Learn more about optimistic people, here:

https://brainly.com/question/14920129

#SPJ2

Click on "Embankment dam at a gold mine." Of the two opinions to consider in this case, which one presents a stronger argument? How does that help you make your final decision as the consulting dam engineer? What was your decision for this dam, as the consultant? How can you accomplish this and still stay within your budget? (Site 1)

Answers

Answer:  The strongest argument is the one that refers to security of people. This helps me to make a final decision, to ensure that there will be no accidents and guarantee that the mine will be used to generate moeny. So my decision is to repair it but choose to repair only the most urgent parts, to still stay within the budget.

Explanation:

A gold mine is a place where gold is extracted from the ground. Because of its value, the extraction of gold generates economic and social benefits all over the world, which has made this activity one of the most important in the world. There are also many ways of extracting this mineral.

The best argument will be the one that indicates the greatest concern for the safety of the citizens of that city or town. If there is a dam, it should be repaired in the best possible way. This will ensure the safety of the town and guarantee that the mine continues to be used, to generate economic benefits. Then, if the gold mine continues to be used even if it is not productive as it was, it must be repaired. However, in order not to make large expenditures and have a low budget for repair, I can choose to repair only the most urgent or necessary part.

So, the strongest argument is the one that refers to security of people. This helps me to make a final decision, to ensure that there will be no accidents and guarantee that the mine will be used to generate money. So my decision is to repair it but choose to repair only the most urgent parts, to still stay within the budget.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

how long does it take a p-wave to travel 5,200 km?

Answers

Eight minutes twenty second

Explanation:

Feedback

Structure that organizes motion of the chromosomes?

Answers

Answer:

Structure that organizes motion of chromosomes. Cytoplasm. Material in cell; contains chemical wealth: sugars, amino acids, and proteins a cell uses to carry out everyday activites. Vacuole. Saclike structure (large in animal cell); stores water, salts, carbs, and proteins. Plays a role in disposing waste.

Explanation:

There are various structures that are found present in a cell. And these structures have peculiar functions they carry out in the cell. Chromosomes are found in the nucleus of a cell. During cell division there is the needed movement of the chromosomes.

The structure that organizes motion of the chromosomes is the centriole

The centriole is a structure found in the animal cells near the nucleus that aid in the movement of chromosomes through the action of the microtubule and spindle fibres. They help to assemble these microtubules and spindle fibres to aid movement of chromosomes.

Learn more: https://brainly.com/question/24552946

what element must a molecule contain to be considered organic?

Answers

Answer:CarbonExplanation:

Organic compound, any of a large class of chemical compounds in which one or more atoms of carbon are covalently linked to atoms of other elements, most commonly hydrogen, oxygen, or nitrogen. The few carbon-containing compounds not classified as organic include carbides, carbonates, and cyanides.

hope this help!

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

Which is true about all unicellular and multicellular organisms?
O They are made of one cell.
O They reproduce.
They cause infections.
O They are made of multiple cells.

Answers

They both reproduce

Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule

Answers

Molecule dddddddddddddd
It is a molecule because you can already cross out cell and matter and atom.

Urey and miller cooked a "primordial soup" with Hadean gases, water snd electricity to make _____,_____,_____ and_____

Answers

Answer:

Urey and miller cooked a "primordial soup" with Hadean gases, water and electricity to make glucose, acetic acid, amino acids and lipids.

Explanation:

In the Miller-Urey experiment, the aim was to reproduce the conditions of the earth before the existence of life, with the objective of demonstrating the formation of organic matter from inorganic molecules.

The scientists took water and gases present in the Hadean eon —previous to the existence of life— such as methane, carbon dioxide, hydrogen, nitrogen and even ammonia, the primordial soup. This mixture was subjected to electrical discharges, inside closed containers.

The results were some organic molecules, including glucose, acetic acid, amino acids and fatty acids. In these results the presence of macromolecules, such as proteins or nucleic acids, is not appreciated, however it was a significant contribution to the knowledge of the origin of life on earth.

in cell A, what is the structure labeled X?

Answers

Answer:

Yo i dont know but when someone does please help me bro

Explanation:

In cell A, the structure labeled X is a centriole.

Centrioles are cylindrical organelles found in animal cells, usually existing in pairs called the centrosome. They play a crucial role in cell division by organizing and forming the spindle fibers during the process of mitosis and meiosis.

Centrioles are involved in the separation of chromosomes, ensuring that each daughter cell receives the correct number of chromosomes.

Additionally, centrioles are essential for the organization of microtubules in the cytoskeleton, which provides structural support and maintains cell shape.

Their function in cell division and cellular organization makes centrioles vital components of animal cells.

Know more about centriole:

https://brainly.com/question/909799

#SPJ6

Pea plants can have yellow seeds or green seeds Which conclusion about the meaning of Y is correct if the allele
combination Yy is for yellow seeds?
O yellow and dominant
O green and recessive
O yellow and recessive
Ogreen and dominant
Save and Exit
Next
Submit
Mark this and retum

Answers

Answer:

yellow and dominant

Explanation:

Gregor Mendel has stated that a gene comes with two alleles. According to his law of dominance, one of the alleles called DOMINANT allele is capable of masking the phenotypic expression of another allele called RECESSIVE allele.

In this question involving a seed color gene, which has two alleles Y and y. Y, which represents the dominant allele codes for the YELLOW trait while y, which represents the recessive allele codes for the GREEN trait. Therefore, a plant with Yy will have YELLOW SEEDS because the dominant allele (Y) is present.

do woody stems die off each winter and grow back the next spring

Answers

no they can survive the winter

At which points (A, B, C, or D) in the curve is light a limiting factor?

Answers

Answer:

D

Explanation:

Other Questions
Which of the following statements about the North and/or South are true?A. The North was less industrialized and had a lower literacy rate than the South.B. Wealthy planters were at the top of the South's social hierarchy and relied on slaves for cheap labor.C. The South favored more federal government involvement and higher tariffs.D. The North's economy focused on agriculture, while the south's focused on manufacturing. An investment counselor calls with a hot stock tip. He believes that if the economy remains strong, the investment will result in a profit of $10,000. If the economy grows at a moderate pace, the investment will result in a profit of $30,000. However, if the economy goes into recession, the investment will result in a loss of $30,000. You contact an economist who believes there is a 30% probability the economy will remain strong, a 60% probability the economy will grow at a moderate pace, and a 10% probability the economy will slip into recession. What is the expected profit from this investment? 8 - 3x4 + 6/2 whats the answer? help plz i really need help why is human resources essential for country Sally is a world champion boxer. She got mad at Cathy and hit her, knowing she might die from being hit that hard. Cathy did not die and was instead knocked unconscious. While unconscious, Cathy threw up and choked to death (adapted from People v. Ginger, which was not about boxers).CAN SALLY BE CONVICTED FOR THE DEATH OF CATHY? The promise of new jobs in the us would be considered a how dos a human being become socialized from community The midpoint of AB is M(4,1). If the coordinates of A are (2,8), what are thecoordinates of B? work out the value of 2 ^ 0 what function does this graph represent across five aprils chapter 5 questions You would like to know whether silicon will float in mercury and you know that can determine this based on their densities. Unfortunately, you have the density of mercury in units of kilogrammeter3kilogrammeter3 and the density of silicon in other units: 2.332.33 gramcentimeter3gramcentimeter3. You decide to convert the density of silicon into units of kilogrammeter3kilogrammeter3 to perform the comparison. By which combination of conversion factors will you multiply 2.332.33 gramcentimeter3gramcentimeter3 to perform the unit conversion? The code red in the hospital use in a sentece Which of the following is NOT a positive effect of increased social interaction?A) Becoming more isolated and more intravertedB) Knowing that others think an individual is a good person to be aroundC) Decreased loneliness and an increased sense of belonging somewhereD) Knowing that there is someone there when an individual reaches out for help or some to notice when help is needed and not asked for it Please hurry 100 points and Watch this video and answer the questions below.The for the video is Research one of the following abolitionists: Sojourner TruthHarriet Beecher StoweWilliam Lloyd GarrisonWhat ideals did they share? How did they compare as individuals? Why do you think we learn about Frederick Douglass in comparison to other abolitionists?How were they embraced by the black community? y - 7.3 = 2(x - 8.8) slope = some helps plssss i need help A menagerie consists of seven brown dogs, two black dogs, six gray cats, ten black cats, five blue birds, six yellow birds, and one black bird. Deter- mine which of the following statements are true and which are false. a. There is an animal in the menagerie that is red. b. Every animal in the menagerie is a bird or a mammal. c. Every animal in the menagerie is brown or gray or black. d. There is an animal in the menagerie that is neither a cat nor a dog. e. No animal in the menagerie is blue. f. There are in the menagerie a dog, a cat, and a bird that all have the same color. A submarine dives below the surface, heading downward in three moves. If each move downward was 25 12 feet, where is the submarine after it is finished diving? 9a = b^3 + 4HHow do you solve for a