Answer:
D- Ability to reproduce
(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?
Answer:
Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.
Explanation:
Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!
A man is 1.7 m long. An amoeba is 17 um long. How does the length of the
man compare to the length of the amoeba?
What molecules will carry the electrons to the electron transport chain?
Answer:
electron and nuetrons
The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.
These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.
The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.
Learn more about the electron transport chain, here:
https://brainly.com/question/33834922
#SPJ4
Which of the following is not true about prokaryotic cells?
Answer:
Prokaryotes lack a true nucleus with well defined nuclear membrane and other membrane-bound organelles. Mitochondria are the double membrane bound organelle and hence is absent in prokaryotes. Mesosome is an extension of the cell membrane presence in the cytoplasm as infolding and serves to increases surface area and as a site for cellular respiration in prokaryotes. Histones are positively charged proteins that serve in the packaging of negatively charged eukaryotic DNA but are absent in prokaryotes.
So, the correct answer is option A.(DNA is complexed with histones).
The statement which is not true for prokaryotic cell is that they are all parasitic. Thus, the correct option is C.
What is Prokaryotic cell?Prokaryotes are the organisms whose cells lack a nucleus and other membrane-bound organelles. Prokaryotic organisms are divided into two distinct groups which are the bacteria and the archaea, which scientists believe to have the unique evolutionary lineages. Most of the prokaryotes are small in size, single-celled organisms which have a relatively simple structure.
Examples of prokaryotic organisms are blue-green algae, bacteria and mycoplasma. Among the prokaryotes, bacteria are the most common and multiply very fast.
Therefore, the correct option is C.
Learn more about Prokaryotic cell here:
https://brainly.com/question/18348786
#SPJ6
Your question is incomplete, most probably the complete question is:
Which one of the following is not true of prokaryotes ?
(a) They are living cells
(b) They lack a nucleus
(c) They all are parasitic
(d) They are both archaea and bacteria
FIRST TO ANSWER IN DIFFERENT SENTENCES GETS BRAINLIEST
Answer:
1.An example of Batesian mimicry is when the yummy viceroy butterfly mimics the orange and black coloration of the distasteful monarch butterfly. ... Wasmannian mimicry occurs when the mimic resembles it's host (the model) in order to live within the same nest or structure. For example, several beetles closely resemble ants
2.Orange and black Monarchs (Danaus plexippus) are among the most familiar and easily recognizable butterflies found in the vivarium. Bright colors and distinctive wing patterns can be an example of aposematism, also known as a warning coloration.
Explanation:
please mark me as the brainliest answer and please follow me for more answers to your questions
1. Why were populations able to get so big? What happened that allowed this to happen?
2. What do you think will happen if the populations of humans continued to increase
3. What could happen that could limit the population or cause it to decrease ( Stop growing )
Answer:
1. reproduction
2. we could run out of food as not enough is produced fast enough
3. lack of food, women and men who are infertile or diseases which can kill people
Help I don’t get it the last one says negative
Answer:
Negative (Fourth Choice)
Explanation:
According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.
Is it possible for you to be more related to one grandparent than another?
Answer:
No because you should get half the DNA from your parents meaning you should be related to the grandparents equally
Answer:
The question isn't clear, can you restate it ?
Explanation:
Please anybody! I been struggling for a while now :(
Answer:
excess nitrates cause algae blooms
Explanation:
Number 15 which of the following is a function of carbohydrates?
Answer:
Option (c) cell wall.
Explanation:
Carbohydrates helps to forms the cell wall. Cellulose is a carbohydrate and it is found the plant cell wall.*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answer:
which are the letters with hightlight yellow?
Which list places the layers of the sun in the correct order from innermost to outermost?
Corona, photosphere, chromosphere
Photosphere, convective zone, radiative zone
Convective zone, chromosphere, corona
Radiative zone, corona, convective zone
(the third choice is wrong)
Answer: The inner layers are the Core, Radiative Zone and Convection Zone. The outer layers are the Photosphere, the Chromosphere,
Explanation: Hope this helped! :)
Which phrase describes one main feature of the atmosphere
Answer:
protects earth's surface
I hope this helped you!
explain how matter behaves differently than energy in a ecosystem
Answer:
Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.
How many atoms of each element are in the chemical formula NH4NO3?
1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen
Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?
Answer:
DNA ligase
Explanation:
Answer: The nucleus
Explanation: I got it right on the test.
Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?
A.Electron
B.Neutron
C.Nucleus
D.Proton
Answer:
Nucleus
Explanation:
please answer. number 17
Answer: Carbohydrates
Explanation:
Which statement does NOT accurately describe eukaryotic and prokaryotic cells?
Answer:
You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.
For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.
Prokaryotic cells are found in the domain(s) Bacteria and Archaea.
True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.
A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.
There is only _1_ eukaryotic domain, it is Eukarya.
Nutrients can come from what 3 natural sources?
Answer:
Nutrient-rich soil or water contains large amounts of nitrogen, carbon, phosphorus, sulfur, and potassium. These nutrients can come from natural sources, like plant and animal remains. As plants and animals die, they decompose. Decomposition releases nutrients into the environment.
what is the relation between weight of the body and weight of the heart
HELPPPPPP ME PLEASEEE
Answer:
building blocks of life
Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function.
You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment
Answer:
C. Hypothesis
Explanation:
Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle
The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.
GlycolysisGlycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.
Citric acid cycleThis is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.
Acetyl CoA formationThe pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.
Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.
Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539
Answer:
It's B
Explanation:
I took one for the team.
2. What is the process of making energy within mitochondria called?
Answer:
Mitochondria Function
Explanation
Cellular respiration is the process of making ATP using the chemical energy found in glucose and other nutrients. In mitochondria, this process uses oxygen and produces carbon dioxide as a waste product.
Each student in a science class of 25 performed the same experiment. Each student shares their data and it is
recoded on a class data table. Tamara compared the data that she personally collected in her experiment to the
data collected by the rest of her classmates.
Which of the following might indicate to her that her results are valid?
Answer: three other classes performed the same experiment.
Explanation:
What property causes the cohesion of water molecules that moves water through a plant against the force of gravity?
Answer:
I believe the answer is polarity, though I am unable to find an exact statement.
Explanation:
I believe it is polarity because of the way water moves through a plant and its relation to gravity.
When and how were the first trans fats made with vegetable oil?
Answer:
Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.
What two elements are major building blocks in glucose, fructose, and sucrose?
A. Nitrogen and iodine
B. Carbon and hydrogen
C. Carbon and fluorine
D. Phosphorus and helium
Answer:
B
Explanation:
what are the roles of plate tectonics in the continental shelf?
Answer:
t
Explanation:
Answer:
A continental shelf is a portion of a continent that is submerged under an area of relatively shallow water known as a shelf sea. Much of these shelves has been exposed during glacial periods and interglacial periods. The shelf surrounding an island is known as an insular shelf.
Explanation:
