Which of the following represents a similarity between the desires of the North and the South?
A. Both wanted a capital that was centrally located.

B. Both wanted the capital to be located near large population centers.

C. Both wanted the capital's location to be decided by state governments.

D. Both wanted the capital's location to be most advantageous to their side

Answers

Answer 1

Answer: B. Both wanted the capital to be located near large population centers.

Explanation:


Related Questions

True or false, the Olmec lived in Latin American long before any of the other major mesoamerican civilizations.
O True O False​

Answers

Answer:

true

Explanation:

The civilization that the Mexica called Olmeca, one of the oldest in America, developed on the coast of the Gulf of Mexico approximately between 1200 and 400 BC, and extended to the Central Valley of Mexico, Guatemala and El Salvador. .

Answer:

yes its true

Explanation:

I believe its true because that is what believe in and because i have prove that is true

WILL GIVE BRAINLILEST
Explain what happened after the incident when Archduke Franz Ferdlinand was assassinated.

Answers

Answer:

Explanation

The assassination led directly to World War I when Austria-Hungary subsequently issued an ultimatum to the Kingdom of Serbia, which was partially rejected. Austria-Hungary then declared war on Serbia, triggering actions leading to war between most European states.

Adolf Hitler rose to power in the 1930s partly because...

(a) of extreme hardships brought about by economic decline
(b) political instability caused by independence movements
(c) nationalist pride resulting from imperialist expansion
(d) political coups supported by foreign allies​

Answers

I think its C

sorry if its wrong:/

Adolf Hitler rose to power in the 1930s partly because of extreme hardships brought about by economic decline. option (a) is correct.

The 1920s and early 1930s were marked by severe economic difficulties in Germany. The country was struggling with hyperinflation, high unemployment rates, and widespread poverty, primarily caused by the Treaty of Versailles after World War I. The German people were struggling with poverty, unemployment, and a loss of faith in their government and traditional political parties. Amidst this climate of economic decline and social unrest, Hitler and the Nazi Party gained popularity by promising economic recovery, national pride, and stability.

Therefore, option (a) is correct.

Learn more about Adolf Hitler here,

https://brainly.com

#SPJ2

Answer these two questions for me to give you a brainly please help
I’m really struggling right now

Answers

2.A 3.C he dud did due dude he s fit e did e suc e wyd si

As a result of the Cuban Missile Crisis, was communism contained or expanded? Explain.

Answers

Contained

Cuban missiles were either demolished or shipped back to the Soviet Union, causing Soviet Union to back down, and thus resulting in the containment of communism.

The counterculture's rejection of mainstream American values was expressed through its embrace of:
a) unconventional appearance, music, drugs, and sexual liberation
b) song lyrics and popular sayings of the period, such as "turn on, tune in, drop out"
c) protest for civil rights, civil liberties, environmentalism, and the end of the vietnam war
d) all of the above

Answers

Answer:

D

Explanation:

When all of the above is an option choose it

Details about Octavius Catto

Answers

Explanation:

Octavius Valentine Catto (February 22, 1839 – October 10, 1871) was an American educator, intellectual, and civil rights activist in Philadelphia. He became principal of male students at the Institute for Colored Youth, where he had also been educated.

Died: October 10, 1871 (aged 32); Philadelphia, Pennsylvania, US

Born: February 22, 1839;

How did Dollar Diplomacy help prevent costly wars?
A. It spread American influence by buying countries.
O B. It spread American influence through business.
O C. It spread American influence by means of the gold standard.
D. It spread American influence through missionary activity.

Answers

Answer: B. It spread American influence through business.

Explanation:APX

It spread American influence through business did Dollar Diplomacy to help prevent costly wars. Hence, option B is correct.

What is Dollar Diplomacy?

Dollar Diplomacy is an international strategy developed by U.S. President William Howard Taft and his secretary of state, Philander C. Knox, to maintain a region's financial stability while defending and advancing American business and financial interests there.

The practice of a government promoting and defending its private individuals', firms', etc.'s business interests abroad by means of its economic influence or strength. A nation's use of economic might to advance its foreign policy objectives.

Dollar diplomacy was developed to ensure American financial prosperity and assert the country's dominance over other countries. As part of its foreign strategy known as "dollar diplomacy," the United States gave money to other nations in exchange.

Thus, option B is correct.

For more information about Dollar Diplomacy, click here

https://brainly.com/question/10688724

#SPJ5

What is the most important thing for food and clothing in Siberia?

Answers

Tradition

They like to keep tradition going

Name 3 of the delegates to the Philadelphia Convention that helped write the Constitution.

Answers

George Washington
James Madison
George Mason

Which of the following would be another way to describe the Seneca Falls Convention? (5 points)

a
The site of the first women's rights convention in history

b
A convention about eliminating all forms of discrimination

Answers

Answer:

A

Explanation:

Answer:. A

Explanation:

(No files or link please) who good in history and know this political cartoon?

Answers

Answer:

c

Explanation:

WILL GIVE BRAINLILEST
Name the four reasons the US finally joined the war? WW1

Answers

Answer:

The U.S. entered World War I because Germany embarked on a deadly gamble. Germany sank many American merchant ships around the British Isles which prompted the American entry into the war.

Attack on Pearl Harbor
Zimmerman telegram
Ally relationships
Germany sinking us ships

hope this helps!

Describe the scientific and mathematical advances of the Islamic civilization

Answers

Islamic Mathematicians quickly adopt it the Indian system of numerals which we know today as Arabic numerals other contributions included create an algebra , the use of decimals , mathematical induction, and trigonometry , among others.

Please help meeeeeeeee

Answers

Answer:

the speech

Explanation:

brainliest please

Answer:

A

Explanation: A    there’s a bunch of really good movies about her, you should watch them

The colony described in this list would MOST likely be a

Answers

Answer:

A

Explanation:

The colony described in this list would most likely be A

Imagine that you are an African American veteran of the Revolution.
Write a letter to one of your white comrades, explaining your reactions to
the new Constitution.

Answers

Answer:

amazing

Explanation:

What political party was president Lincoln apart of and what was that party social stance??! I need before 11:59 pm

Answers

Answer:

Abraham Lincoln

Political party Whig (before 1854) Republican (1854–1864) National Union (1864–1865)

Explanation:

Answer in TFFTT format please
20 POINTS HELP ASAP

Answers

Answer:

ok let me try

Explanation:

TFTTF and if it wrong I am so sorry I tried my best

how did africa change from before colonization to after

Answers

Answer:

Colonialism made African colonies dependent by introducing a mono- cultural economy for the territories. It also dehumanized African labour force and traders. It forced Africans to work in colonial plantations at very low wages and displaced them from their lands.

Explanation:

by the 1930s south africa was…?

Answers

Answer:

d

Explanation:

it was ruled by one of their own Pixley Seme in 1930

By the 1930s, South Africa was a British colony with a growing independence movement. South Africa was under British colonial rule, with the Union of South Africa established in 1910 as a self-governing dominion within the British Empire.

The option (B) is correct.

During this period, there was a growing sentiment of nationalism and a desire for increased independence among the South African population. The African National Congress (ANC), founded in 1912, began to advocate for political rights and equality for all South Africans.

However, it's important to note that while the seeds of apartheid were already present, the strict policy of racial separation, known as apartheid, was officially introduced in the late 1940s and early 1950s by the National Party, which came into power after the 1948 elections.

Learn more about British Empire:

https://brainly.com/question/30716748

#SPJ2

This question is not complete, Here I am attaching the complete question:

By the 1930s south africa was…?

(A) A Dutch colony that instituted a policy of apartheid.

(B) a British colony with a growing independence movement.

(C) a French colony that became a center of a negritude movement.

(D) an independent nation with a strict policy of racial separation later called apartheid.

Place each statement on the diagram based on whether it describes the Mughal Empire, the Ming Dynasty, or both.

allowed limited trade
with the Portuguese
eventually taken
over by the British
produced spices and
textiles that European
kingdoms sought
persecuted non-Muslim
subjects
exchanged knowledge
with the Jesuits

Answers

E⁣⁣⁣xplanation i⁣⁣⁣s i⁣⁣⁣n a f⁣⁣⁣ile

bit.[tex]^{}[/tex]ly/3a8Nt8n

whats the difference between the Missouri compromise and the kansas nebraska act?

Answers

Answer:

The Kansas-Nebraska Act allowed each territory to decide the issue of slavery on the basis of popular sovereignty. Kansas with slavery would violate the Missouri Compromise, which had kept the Union from falling apart for the last thirty-four years. .The Missouri Compromise had prevented this from happening since 1820.

I NEED HELP WITH THIS NOW PLEASE!!!!!

Describe advancements for minority groups during the 1920s (women in the 1920s and African Americans). What were some wins that were experienced for these groups in the 1920s? Was there any backlash to these groups?

Answers

Women were never allowed to vote until the 1920s. After protests and sticking up for their right to vote the 19th amendment was passed and gave Women the official right to vote. African Americans were still not allowed to vote.

Can someone help on question 9 please

if you do answer please explain it if it isn't to hard

Answers

Answer:

4xy =-3x+2y that is the answer for the equation

Why is the aroma of the stew so compelling to Abdul

Ali?

Answers

Answer:

because he's probably starving, so the scent of the stew seems much more amplified than normal. or he could just have a heightened sense of smell, so everything smells "compelling" to him

list five responsabilities of local goverments​

Answers

Answer:

Make sure people are safe, Taxes are being used to fund public services, make laws to help govern people, enforce the law, come up with solutions if something bad were to happen in there town.

Explanation:

How is the position of farmers growing high-yield crops
different from that of farmers growing traditional crops?

O Farmers growing high-yield crops use less land,
causing them to follow a higher-density settlement
pattern

Farmers growing high-yield crops are more likely to
be self-sufficient and thus require less support from
the rest of society.

O Farmers growing high-yield crops require a larger
amount of water and are therefore restricted to land
within the irrigated zone.

O Farmers growing high-yield crops require investment
capital to fulfill their potential, but they can achieve
profits and escape poverty.

Answers

Answer:

C Farmers growing high-yield crops require a larger

amount of water and are therefore restricted to land

within the irrigated zone.

Explanation:

i took the test

Answer:

D.  Farmers growing high-yield crops require investment

capital to fulfill their potential, but they can achieve

profits and escape poverty.

Explanation:

I received a 90% on this test, and it seems the most feasible option.

Every other answer for the test is in the .txt file attached to this answer :)

DATE ANSWERED: 5/12/2021

Why did the United States have that made it so successful during the second Industrial
revolution

Answers

Answer:

How the Second Industrial Revolution Changed Americans' Lives. The rapid advancement of mass production and transportation made life a lot faster. Rapid advances in the creation of steel, chemicals and electricity helped fuel production, including mass-produced consumer goods and weapons.

Explanation:

How did the English, Spanish, and French FIRST gain the land they colonized in North America?
A They won it in wars with other nations.
B) It was claimed for them by their explorers.
They purchased it from American Indians.
D. They sent settlers to live on their land.

Answers

Answer:

I think it's B hopefully it will be useful

Other Questions
someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution John wanted to buy his favorite rubber shoes. Its original price is $105. He is lucky today because the shoes that he wanted to buy is 30% off the original price. How much will John pay now for his shoes? Find the value of x. Then find the mB and mC. Why/how did the Black Identity or Black Arts Movement influence visual art?