Answer:
four-part protein
Explanation:
The blue people of Troublesome Creek had methemoglobinemia, a metabolic condition affecting hemoglobin, the four-part protein that carries oxygen bound to an iron atom at each subunit's core.
Hope this helps:)
Answer:
The blue people of Troublesome Creek had methemoglobinemia, a metabolic condition affecting hemoglobin, the four-part protein that carries oxygen bound to an iron atom at each subunit's core.
Explanation:
PLEASE MARK ME AS BRAINLIEST
A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).
Answer:
The allelic frequency for pointed ears is 0.5 (50%).
Explanation:
The frequency of alleles in a population must add up to 1 (100%).
The allelic frequency for pointed ears is 0.5 (50%).
What is allelic frequency ?The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.
What is the difference between gene frequency and allele frequency?Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.
To learn more about allelic frequency , here
https://brainly.com/question/23362399?referrer=searchResults
#SPJ2
What are the two resulting cells formed from single cell called
What do coal deposits tell you about the continents?
Answer:
Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.
The coronavirus attaches to a membrane protein called
Answer:
M glycoprotein..
The coronavirus attaches to a membrane protein called M glycoprotein..
What is the purpose of cellular respiration. In a short sentence
Answer:
Produce energy (in the form of ATP) for metabolic processes and muscle contraction.
Explanation:
What is a simple diffusion?
Answer:
movement of a solute from an area of high concentration to an area of low concentration
Explanation:
what would the chromosome to the right be called?
Answer:
The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.
Explanation:
Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:
(1). Telocentric chromosomes.
(2). Acrocentric chromosomes.
(3). Sub-metacentric chromosomes.
(4). Metacentric chromosomes.
What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell
Answer:
This question lacks options, the complete question is: What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell, or a harmful mutation in an adult multipotent stem cell?The correct answer is a harmful mutation in a pluripotent embryonic stem cell.
Explanation:
Pluripotent Stem Cells can self-renew and differentiate into any of the three germ layers, which are: the ectoderm, the endoderm and the mesoderm. These three germ layers subsequently differentiate to form all the tissues and organs within a human being. If during embryonic development, genetic mutations - alterations in genes - occur in the embryonic stem cell, they pass to daughter cells as a consequence of cell division, and an individual is generated whose cells differ at the genetic level. Multipotent stem cells are organospecific cells, that is, they can give rise to any type of cells but from a specific organ (a lung, a kidney or the brain). Their differentiation ends the moment they specialize and become a cell with a specific function within a specific tissue or organ. If there were a mutation in these cells, it would damage a specific designed tissue or organ.
Hey My Name is Chloe, and I need some Help, But if you can't it's ok,
So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine
Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.
Explanation:
Answer: Animal: Bengal tigers
Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world? Are bengal tigers being bred in captivity.
Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.
Explanation: I would suggest looking at national geographic if you want cooler animals.
The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation
Answer:
I am pretty sure that the answer is C.
Hopes this helps.
Have a great day!!!!!!!
PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)
Communicating verbally and nonverbally
Attempting to convince peers to alter their beliefs
Excluding or ignoring
Dressing a certain way or participating in a certain activity
Answer:
excluding or ignoring= rejection
Dressing a certain way or participating in a certain activity= unspoken pressure
Attempting to convince peers to alter their beliefs= pressure
Communicating verbally and nonverbally= insults (?)
I neeed helppppppp
Chemical Weathering 5 facts about it
Answer:
5 Facts
Explanation:
1. When it comes to chemical weathering, it’s all about chemistry. By looking at the term “chemical weathering,” you can see that a chemical reaction causes something to break down or “weather.” That “something” is rocks and minerals.
2. In chemical weathering, rocks and minerals are reacting to acids, oxygen, carbon and water. That’s why no two rocks ever look exactly the same. It’s also the reason that we have those awesome looking caves and unique rock formations all over the world.
3. While chemical weathering creates nifty formations, the way it breaks down rocks also causes fractures in ancient structures like the Great Sphinx of Egypt. It also causes the surface to break down on gravestones.
4. Chemical weathering types can work separately, but they often work together to create landforms and break down minerals.
5. Acid rain caused by pollution such as factory and car exhaust is another agent of chemical weathering.
Each of the following is a density-dependent limiting factor EXCEPT:
- crowding
- predation
- competition
- disease
Answer:
predation
Explanation:
predation
I hop this answer is correct
Answer:
Disease
Explanation:
What is the definition for polyploidy?
At the zoo, Anya observes that individuals of a certain kangaroo species have slightly different sizes and colors. What characteristic of populations is Anya observing?
O adaptation
O evolution
O selection
O variation
True or False.
A group of the same species of living things in an area is a population
Answer:
True.
Explanation:
A population is a group of organisms of the same species that live in the same area at the same time
Answer:
True!
Hope this helps.
Question 1/7 The Nile River carries sediments to the ocean. Over time, the sediments are compressed as more sediments are deposited on top of them. Which type of rock will be formed?
Answer:
Sedimentary Rock
Explanation:
Sedimentary rocks are formed from pieces of sediments or other existing organic matter or rock.
The sedimentary rock formation process begins with weathering which involves the breakdown of the sediments into small fragments. The next process is erosion, where water like the Nile River carries them to other places - in this case, the Ocean.
Over time, the sediments settle and become compressed as more sediments are deposited on top of them.
This leads to the formation of Sedimentary Rocks.
Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.I will give you any mark you want.
Answer:
The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.
Pls, I need help with this! Biology Thank you :)
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
How do antibiotics work? Note: you will not be given credit for simply stating “they prevent bacterial growth” or “they kill bacteria”
Answer:
here's your answer
Explanation:
May this helps you..
the question are in the Picture:) Please help me :)
Answer:
Birds
Explanation:
1. Wings
2. Flight feathers and beak
3. For survival purposes
Which kind of worm is sometimes used to prevent blood clots?
planarian
leech
fluke
hookworm
Answer:
Leech
Explanation:
leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.
Answer:
a leech i got it correct on edu!
Explanation:
A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.
The weight of the man will...
Explanation...
Answer:
Increases.
Explanation:
A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.
The North Pole and the South Pole are
A:Classified as tundra biomes
B: Not home to any animals
C: not classified into major biomes.
D: Part of Aquatic Ecosystems
Answer:
A
Explanation:
classified as tundra biomes
the ___severs as a relay station between the hindbrain and the forebrain.
A. forebrain
B. Midbrain
C.cerebral cortex
D. hindbrain
Answer:
B. Midbrain
Explanation:
I'm pretty sure this is it.
please help ::( i wanna pass w good grades
Answer:
It's catabolism I think
Explanation:
Answer:
Catabolism
Explanation:
Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.
Which of the following are prokaryotic cells?
A) plants
B) fungi
C) bacteria
D) animals
E) B and C only
fungi, bacteria
If I remember right, eukaryotic means there's more than one, so I believe this answer is right
Match each term to the appropriate description.
Answer:
Have a great day!
Explanation:
The appropriate term for each description would be ecosystem, community, population, organism, and species respectively.
Definition of ecological terms?An ecosystem is a community of all living organisms interacting with their environment as a system.
A community is a collection of different populations of organisms.
A population is a group of organisms of the same species capable of mating.
Species are a group of organisms that is capable of breeding to produce fertile offspring.
Thus, the term for each description would be ecosystem, community, population, organism, and species respectively.
More on ecological terms can be found here: https://brainly.com/question/13046612
#SPJ2
PLZ HELP I"LL GIVE BRAINLIEST
Answer:
gotchu
Explanation:
1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)
2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal
b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster
3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.
4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women
5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD
6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids
Try to move the different parts of the body
by moving it back and forth, side to side,
rotating, and swinging.
The given question is incomplete, however, the missing part is as follows:
body parts movement
neck _____
lower arm _______
upper arm ________
wrist __________
shoulder _________
skull _________
knee _________
hipbone _________
elbow _________
ankle _________
Answer:
The correct answer is given as follows:
Explanation:
A. side to side
B. swinging
C. rotating
D. rotating
E. rotating
F. back and forth
G. swinging
H. side to side
I. back and forth
J. rotating