Mathematics Middle School

What is the result when 3/8x + 2 1/5 is subtracted from 3 1/2x - 4 1/10?

Don’t put a link.

What Is The Result When 3/8x + 2 1/5 Is Subtracted From 3 1/2x - 4 1/10?Dont Put A Link.

Answers

Answer 1

Answer:

Option 3 3 1/8x - 6 3/10

Step-by-step explanation:

(3 1/2x - 4 1/10) - (3/8x + 2 1/5)

Divide it into parts:

(3 1/2x - 3/8x) + (-4 1/10 - 2 1/5)

3 1/2x - 3/8x = 3 4/8x - 3/8x = 3 1/8x

-4 1/10 - 2 1/5 = -4 1/10 - 2 2/10 = -6 3/10

So we get:

2 1/4x - 6 3/10

Answer 2
trying to cheat on a performance matter test but the answer is the last one -3 1/8 x + 6 3/10

Related Questions

1. The chairman of the community bazaar is assigning people to chair committees. How many different
ways can the 6 people be assigned to chair the subcommittees?

Answers

720 if i got the question wrong <43

using the interquartile range (IQR), determine if the data set contains any outliers. name the outlier or choose no outliers. {63, 88, 89, 89, 95, 98, 99, 99, 100, 100}
A. 63
B. 74
C. no outliers
D. 100

Answers

A 63 i had this on a test and this was the right answer
The answer is A. Hope this helps!

Complete the sequence: 0, 5, 1, 6, 2, 7, _____, _____.

Answers

Answer:

3, 8

Step-by-step explanation:

Brₐinliest plz close to leveling up

The answer is 3,8 so it would be 0,5,1,6,2,7,3,8

please help im stuck in a place where i do not wanna be

Answers

Answer:

Answers listed below

Step-by-step explanation:

1. (0,2)

2. (0,60)

3. (0,3)

4. (0,6)

5. (0,-4)

6. (0,3)

7. (0,-1)

8. (0,4)

9. (0,1)

10. (0,25)

Mark brainliest if this helped

Mark brainliest if this helped

Answer:

Hope this helps

Step-by-step explanation:

Help ASAP please
Find the measure of the sides and angles below

Answers

Step-by-step explanation:

please send clear photo

plss help me on this question

Answers

Answer:

2387.97

Step-by-step explanation:

V = 3.14 x 42.25 x 18

V=2387.97

2387 is the answer









Hope this helps

The unit rate of frames animated per minute is 1.5 and I animated 4 frames in 6 minutes, how would I write this on a table like this one?

Answers

Answer:

i dont know

Step-by-step explanation:

it is 16

Step-by-step explanation:

you do 6 x 4=24 ÷ 1.5=16

Abby wants to buy one shirt for $25 and three pairs of socks for $2 per pair. If sales tax is 8%, how much will she pay in tax?​

Answers

Answer:

28.52

Step-by-step explanation: you're welcome

$25 + ($2 x 3) = $31

8% = 0.08

$31 x 0.08 = $2.48

Answer: $2.48

Find 25% of a pair of AirForce1's that cost $100.

Answers

Answer:

it would be 25 dollors

Step-by-step explanation:

100 divided by 4 is 25

Step-by-step explanation:

[tex]\frac{25}{100} = 0.25\\0.25 = 25%\\\\[/tex]

25/100 is equal to 1/4

Ways to remember your basics.

4 quarters  = 100 (1.00)

1 quarter = 25% of 100 (1/4 or 25/100)

2 = 50  = 50% of 100 (2/4 or 50/100)

3 = 75  = 75% of 100 (3/4 or 75/100)

4 = 100 25% of 100 ( 4/4 or 100/100)

Twenty-eight students reported how many email accounts they have. The dot plot below shows the data collected:

Answers

Answer:

The answer is that There are exactly 6 students with 4 email accounts.

Step-by-step explanation:

Zivia is given the ordered pair (4, 16) from a table. She decides that the quantities in the table form a proportional relationship with a constant of proportionality of 4. Explain whether Zivia has enough information to draw her conclusion.

Answers

Answer:

No

Step-by-step explanation:

You need to have at least 2 points to do that.

if you had the point (4,16) AND (2,7) you could do it

graph the line: y=2/3x-4​

Answers

Graph the line using the slope and y-intercept, or two points.
Slope:
2
3
2
3
y-intercept:
(
0
,
−
4
)
(
0
,
-
4
)
x
y
0
−
4
3
−
2

slope: [tex]-\frac{3}{2}[/tex]

y-intercept: (0, -4) (answer let me know if i am wrong)

Y=2/3x-4 is in Slope - intercept form meaning you are shown the slope (how steep the line is) and the y intercept (where the equation hits the vertical axis)

With the given information, select the point (0, -4) on the graph, this is where the line crosses the y axis, as shown through the -4 in the equation.

Next, look at the slope and you'll see 2/3x. Slope is in format "rise over run" meaning the first number (2) is the vertical change, so up two, and the second number (3) is horizontal change, right 3.

Combine these two steps together and select point (0. -4) then the next point should be at (3,2), 2 units up and three to the right from the y intercept.

This is asking for volume, ROUND TO NEAREST TENTHs

Answers

the answer is 50.5 but the full volume is 50.51

When his bus arrives, Calvin is 40 feet east of the corner. The door of the bus is 30 feet north of the corner.


How far will Calvin run directly across the field to the bus?

(Sorry the image is a little pixelated, also I will give brainliest!)

Answers

Answer:

10 feet.

Step-by-step explanation:

A simple 40-30 type equation

What is the volume of the composite figure below?

Answers

Answer:

18 ft^3

Step-by-step explanation:

Divide it into 3 parts:

The Bottom: 3*3*1 = 9

The Middle: 2*3*1 = 6

The Top: 1*3*1 = 3

9 + 6 + 3 = 18

pls help me on my beestar

Answers

D because -4 is less than -2

Answer:

9. Trapezoid

Step-by-step explanation:

all of them have 2 pairs of parallel sides except a trapezoid

Good Luck!!!

what is the value of x? and how did you do it

Answers

Answer:

x = 45

Step-by-step explanation:

These angles equal to each other. So...

2x + 6 = 96

2x = 90

x = 45

I hope this helps :)

X=45
because
2x+6=96

a truck moving 20m/s. is this an example of speed velocity or acceleration

Answers

Answer:velocity because its talkign about speed Step-by-step explanation:

Answer:

speed velocity bc is moivin sorry i read the ? wrong

Step-by-step explanation:

Gressel the Goblin is making an inventory of Darklord Ganondorf’s treasure horde following a raid by some violent fellow named link. The horde now contains only 2150 gems (as in $). Gressel notices that there were twice as many green-gems (worth 1) as blue-gems (worth 5) and 13 fewer blue gems than red-gems (worth 20). How many red, blue and green gems are there remaining in the horde?

Answers

Answer:

70   blue gems

 

140  green gems

 

83  red gems

Step-by-step explanation:

x + 1*2x  + 20 ( x+ 13)  =  2150   simplify

 

27x + 260 =  2150

 

27x  = 2150 - 260

  the   number of blue  gems  =  x

the number of   green gems  = 2x

the  number of red  gems = x + 13

 

which means  

5x  + 1*2x  + 20 ( x+ 13)  =  2150   simplify

 

27x + 260 =  2150

 

27x = 2150 - 260

 

27x  = 1890

 

What is the volume of the pyramid to the nearest whole unit?

Answers

Answer:

Step-by-step explanation:

V= lwh/3

V= ((6)(11)(6))/3

V= 132 yd^3

Item 5
The lock is numbered from 0 to 49. Each combination uses three numbers in a right, left, right pattern. Find the total number of possible combinations for the lock.



For this lock there are a total number of
possible combinations.

Answers

Answer:

50³ = 125,000

Step-by-step explanation:

49^3 and the answer would be 117,649

guys please help i do not understand this at all please don’t use my question for points or i will take my points back thank you please help:(..

Answers

Answer:

350

Step-by-step explanation:

The upper quartile is the end of the rectangle on the right.

The middle line on the rectangle is the median, and the lower quartile is the end of the rectangle on the left

The upper quartile ends at 350

Answer:

250 visitors

good luck!

help plzz its due soon

Answers

Answer:

The answer is 8

Step-by-step explanation:

answer: 8
this was on my 7th grade quiz for math

big math :) plz help, tank u

Answers

Answer: 641

I believe this is correct, but I did it fast so unsure.. hope this helps :)

A toaster has 4 slots for bread. Once the toaster is warmed up, it takes 35 seconds to make 4 slices of toast, 70 seconds to make 8 slices, and 105 seconds to make 10 slices.
If someone makes as many slices of toast as possible in 7 minutes and 40 seconds, how many slices do you think they can make?

Answers

They can make 192 slices of bread in the 7 minute time span.

pls help me with this true or false question

Answers

Answer:

from my understanding true

Step-by-step explanation:

Answer:

I think it is true

Step-by-step explanation:

If 2 or more are done correctly you'll get brainliest

Answers

Answer:

Answers below

Step-by-step explanation:

1. (-1,-1)

2. (2,-1)

3. No solution

4. (2,2)

Mark brainliest if this helped

Mark brainliest if this helped

Answer:

1, -1

2, 2

3, the statement is false or no solution

4, 2

please Add brainlist I am correct all 4/4

I need help please. Having problems understanding.

Answers

Answer:

you need to find the vertex, y-intercept, x-intercept, etc in order to create the equation.

Step-by-step explanation:

standard form for quadratic equations should look like this:

f(x)= ax^2+bx+c

(The graph is really blurry, try posting just the graph so I can see it closer if you still need help setting up the equation.)

you should get other apps because sometimes they give you wrong answers sometimes

Shakiras two neighbors also want to lay sod in their yard. Help them figure out how much sod they would need.

Answers

6 bottles and I got the water from the water and I was just cleaning my house so I’m just going on a little later I don’t have to
They would need 6 bottles

Middle school math problem.....

Answers

2% or 1/50
r= I/Pt
60/600(5)=1/50
She paid 2% more thanks mark as brainiliest
Other Questions
Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help