Answers
Answer:
C. 1,000x
Explanation:
Answer: 1000x c
Explanation:
Related Questions
What two systems are affected by the common cold and why
Answers
Answer: nose, throat, and sinuses
Explanation:
because its an infection of the upper respiratory system.
If you ate more food from secondary consumers, how would this change the percentage of the biomass pyramid necessary to support your survival?
Answers
Answer:
would increase
Explanation:
The pyramid of biomass is a diagram that exhibits the total biomass of the organisms at different trophic levels, which are required to support life in a given ecosystem. This pyramid usually starts with producers situated on the bottom (e.g., plants), then continues with the organisms that eat these primary consumers (herbivores), after with secondary consumers (carnivores), and so successively. The pyramid of biomass indicates the amount of mass of 1-primary producers required to support the life of the primary consumers, 2- primary consumers needed to support the life of the secondary consumers, 3-secondary consumers needed to support the life of the tertiary consumers, and so successively for each trophic level. In this diagram, the trophic level with a higher amount of biomass (and energy) is usually represented by the producers (i.e., by organisms on the bottom), and this amount of biomass decreases as long as more levels are considered. In consequence, if more food from secondary consumers is consumed, it will produce an increase in the percentage of biomass that is needed to support life.
To change behavior or actions in response to outside conditions 4 Letters. What is the word?
Answers
Answer:
The four-letter word which speaks to the ability of an organism to modify its behavior or actions to external stimuli is Move.
Explanation:
Movement gives organisms the ability to move away from or towards an external stimulus depending on whether it is a detrimental stimulus or a favourable one.
Examples of stimuli are:
Light: All organisms respond to the presence of light. Some stay away from it and remain at sleep until the sun goes down. They are called nocturnal. Others gravitate towards it. Plants always grow towards light.Temperature: Some organisms favour cold environments, other the temperate parts of the earthSound: The sound of a carnivorous animal such as the lion will put a deer to flight. The sound of a mother hen calling out to her chicks will attract them to her.Cheers
The increase in the reproductive success of a species will have the greatest impact on the - size of that species’ population. competition within other communities in the biosphere.. success of other populations in the community. tissues that comprise organisms of that species.
Answers
Answer:
size of that species’ population.
Explanation:
The increase in the reproductive success of a species will have the greatest impact on the size of that species’ population.
A reproductive success rate means more individuals survive birth and get added to the existing population. The more the number of individuals added to a population, the more the size of the population of the species.
An increase in the population size of a species will only increase intra-species competition for resources but have no real impact on the success of other populations in the community.
PLEASE HELP!!!!!!!!!!!!!!!!!!!!
Which statement describes competition within a population?
Several killer whales migrate to a new location.
Two male sea horses fight to win over a female.
Several elk travel together to find and share water.
Different kinds of garden plants take in water from the soil.
Answers
Answer:
I think its B if I'm wrong I'm sorry
Two male sea horses fight to win over a female describes the competition within a population. So, the correct option is B.
What is Competition?Competition is defined as an interaction between organisms or species in which both require a resource in limited supply that reduces the fitness of both organisms because the presence of one of the organisms always consumes the available resource which reduces the quantity.
Competition is defined as the fight between different organisms by limited resources. Some examples of interspecific competition between lions and leopards that vie for the same prey and interspecific competition between rice fields with weeds growing in the field, two male seahorses fighting to win over a female.
Thus, the correct option is B.
Learn more about Competition, here:
https://brainly.com/question/23571652
#SPJ3
(True or False) Amino acids are chemicals which link together to make carbohydrates.
Answers
2. Which of the following does NOT contribute to globalization?
a) Countries protect their trade positions by increasing tariffs on foreign imports
b) Technological advances allow for decreased communications costs
c) Containerization makes international shipping inexpensive
d) Countries ratify new free trade agreements
Answers
Scientists are working with a liquid that is made of only one type of atom. Which statement correctly describes this liquid?
Answers
Answer:
b
Explanation:
edge 2021
Suppose you find a yellow piece of metal in a stream. How could you tell if it’s real gold?
Answers
Answer:
Bite it, if it is soft then its gold
also if it is not shiny
Explanation:
Which molecule in Diagram 11 is used to transport energy to other parts of the plant?
Answers
Answer:
The answer is Sugars, or sugar molecules!
Explanation:
The sugar and other organic molecules are transported through the plant by means of a special layer of tissue called phloem. Phloem is composed of living cells that transport a water solution of sugars that we commonly call sap.
The molecule is Sugar ,transported principally as Sucrose, but originally as Glucose after photosynthesis and stored as starch in plants.
The sucrose is transported in the Phloem( one of the vascular tissues, the second is the xylem. They are located adjacent o each other.)The process of transportation is called, Pressure Flow Model. The process of moving the sugar through the plants is called Translocation.
There are two regions during transport of sugar in translocation. The source where the sugar is produced, that is the green leaves, and the sink where the sugar is metabolized.
Therefore the high concentration of the sugar at the source([plant leaves) increases the solute potential of the cell in the phloem of the leaves. This set up a gradients that draw water from the adjacent xylem into the phloem by osmosis.
The water influx increases the pressure potential of the phloem sap, and which makes the phloem turgid. The creates turgor pressure because of the increases of the phloem sap (containing sugar).The pressure leads to the bulk transport of the sap contain sugar (translocation) from the source( leaves) to the Sink.
At the sink, the sugar is withdraw . Thus the solute potential rises,(with a drop in pressure potential) and water return by osmosis back to the xylem for the process to continue with another transport.
More https://brainly.com/question/18518187
The most common danger related to the destruction of CD4 T cells is
Answers
Answer:
AIDS
Explanation:
AIDS is the most common infectious disease causing lymphocytopenia, which arises from destruction of CD4+ T cells infected with HIV.
do all prostars become stars why or why not
Answers
Answer:
no everyone can get popular but they can reach it if they try hard enough
Explanation:
Answer:
Not all of them because the crown might not like the much so that why they don't become famous
Explanation:
How does the respiratory system help maintain in the body?
Answers
Answer:
The respiratory system works with the circulatory system to provide this oxygen and to remove the waste products of metabolism. It also helps to regulate pH of the blood. Respiration is the sequence of events that results in the exchange of oxygen and carbon dioxide between the atmosphere and the body cells.
ay whether each of the following situations is an example of altruism or reciprocity. a. Giving a few canned goods to the local food bank for its annual food drive: (Click to select) . b. Helping someone move her couch after she helped you study for an upcoming exam: (Click to select) . c. The biological relationship between cleaner fish and large predators in the ocean, in which cleaner fish keep the predator
Answers
Answer:
Altruism
Giving a few canned goods to the local food bank for its annual food driveReciprocity
Helping someone move her couch after she helped you study for an upcoming examThe biological relationship between cleaner fish and large predators in the ocean, in which cleaner fish keep the predatorExplanation:
Altruism is a biological concept used to describe the action of an organism which reduces its own fitness but increases the fitness of another organism. Reciprocity, on the other hand, refers to cooperation between two unrelated organisms in which the beneficial actions of one to the other is reciprocated either in the short or medium term.
Giving a few canned goods to the local food bank for its annual food drive is an action done to benefit those that patronize the food bank without any hope of it being reciprocated. Hence, it is considered altruism.
Helping someone move her couch after she helped you study for an upcoming exam and the biological relationship between cleaner fish and large predators in the ocean, in which cleaner fish keep the predator are both considered reciprocity.
is someone being taller an example of qualitative or quantitative data (ex- i am taller than her)
Answers
Answer:
quantitative
Explanation:
because it can be measured (in feet)
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Answers
GTTCAAGCTACTGTTCAAGCTACT
Sugar made in the process of photosynthesis to sent to the mitochondria to produce _____.
Answers
Answer:
energy
Explanation:
i just know it. i like science
Sugar produced in the process of photosynthesis to sent to the mitochondria, is used to produce energy in the form of ATP through the process of cellular respiration.
What is Cellular respiration?
Energy is produced in the body through the food we eat. The food is broken down into simpler substances which are absorbed by the cells and in the cells are used to produce energy.
Sugar is produced by the process of photosynthesis in plants which is sent to the mitochondria to produce energy in the form of ATP (adenosine triphosphate). The process of oxidation of food to produce ATP is called cellular respiration.
The process of cellular respiration consists of three processes which include glycolysis (breakdown of glucose into pyruvate), citric acid cycle, and the oxidative phosphorylation which produces about 34-36 molecules of ATP in the mitochondria of cell.
Learn more about Energy here:
https://brainly.com/question/22342942
#SPJ2
Scientists use english units of measurement true or false
Answers
Answer:
Falus
Explanation:
explanation: scientist use metric units
Why does the amount of energy available change as you move from one
trophic level to the next? Does this process still follow the Law of
Conservation of Energy? Explain your reasoning.
Answers
Answer:
hope it helps you
Explanation:
Energy decreases as it moves up trophic levels because energy is lost as metabolic heat when the organisms from one trophic level are consumed by organisms from the next level. Trophic level transfer efficiency (TLTE) measures the amount of energy that is transferred between trophic levels.
Why is RNA important to many chemical reactions in your body?
1. RNA produces lipids so your body can store energy, insulate itself, signal, and make cell membranes
2. RNA produces DNA which is important in guiding many cell processes
3. RNA produces many kinds of carbohydrates to store energy
4. RNA produces many proteins, some of which are enzymes that catalyze many reactions in the human body
Answers
Answer:
RNA produces DNA which is important in guiding many cell processes
Answer: RNA produces many proteins, some of which are enzymes that catalyze many reactions in the human body.
Explanation:
I chose the other answer here and it was wrong this is the correct one.
Describe the net movement of water when a dialysis bag containing a 0.2 M sucrose solution is placed into distilled water, which contains no solutes.
a. There will be no movement of water.
b. Water will move into the bag.
c. Water will move into the beaker.
d. There will be no net movement of water.
Answers
Answer:
b
Explanation:
The correct answer would be that water will move into the bag.
The 0.2 M sucrose solution in the dialysis bad has a lesser water potential when compared to the distilled water that has no solutes. By law, water moves from the region of higher water potential to the region of lower water potential. The dialysis bag will, hence, act as a semi-permeable membrane and allow water into the bad from the surrounding distilled water.
The correct option is b.
Select the terms that fit in the science category "Earth and Space." Select all that apply. water air animals land plants solar system light sound
Answers
Answer:
water
air
animals
plants
solar system
light
Explanation:
Earth is one of the nine planets and it is the one known to host human life. Earth is made up of the atmosphere which contains gases needed to sustain life. Water, air, animals, and plants can be found on the earth.
Space is a vacuum that hosts the galaxies and sun which make up the solar system. The Sun emits light which can be reflected on the earth as the planets revolve around the sun.
1. Your arm is made up of four different types of
Answers
Answer:
joints or muscles
Explanation:
Answer:
Tissues
Explanation:
connective, muscle, epithelial, and nervous tissue.
suggest what sort of molecules insulin receptors are and state where they would be found
Answers
Here is what I want you to do. Create a comic strip using one of the following websites. Some of the websites you must pay for, so DON'T PAY for them, just take a screenshot and send it to me in an email.
You can also complete the project using poster board. Either way is fine. Once completed with poster board, you must send it to me by taking a picture through an email.
The key to the assignment is to make sure you will model the structures of the cell and describe their functions. You will do this by completing a table that describes the functions of structures of the cell. The table should also identify factory parts or workers that have similar functions.
The comic strip is just a way to describe the cell structures. It's a scenario (scene) describing the events. The scene is of a reporter who visits a cell “factory” and interviews someone about the structures/organelles and how their roles in the cell are similar to those of a factory and its workers.
Comic Strip Websites:
Answers
Answer:
I just did this test the correct one is B.
Docosahexaenoic acid (DHA) is an omega-3 fatty acid essential for brain development during pregnancy and early childhood. It is also linked to improved heart health, better vision, and reduced inflammatory response.
What is the complementary strand for the following DNA segment?
C A A G T T C G A T G A
Answers
Answer:
GTTCAAGCTACT
Explanation:
studied
A certain plant species has seeds that remain dormant until heat stimulates them to germinate.
• Describe the process of succession that could occur with this species after a wildfire.
• Identify whether the plant species is dependent on succession events and explain how you know.
Answers
Answer:
Explanations: primary succession will take place because these plants will dominate after a wild fire has occured in the area since their growth is stimulated by heat hence the heat will result to the widespread of this type of plant
These plants are indeed dependant on succession events because they are only stimulated to grow through heat events
Secondary succession is that process which occurs after wildfires.
What is Secondary succession?In this type of ecological succession, the plants and animals recolonize a habitat after a major disturbance such as a devastating flood, wildfire, landslide, lava flow, or human activity etc.
Yes, the plant species is dependent on succession events because that event make the environment suitable for the growth of some plants so we can conclude that Secondary succession is that process which occurs after wildfires.
Learn more about succession here: https://brainly.com/question/1212975
*WILL MARK BRAINLIEST!!* and you don't have to answer all of them! :D
A.) The middle lamella _____.
1.)surrounds and protects the chloroplast
2.)stores water inside the plant cell
3.)attaches plant cells to one another
4.)captures sunlight for use in photosynthesis
B.)Organisms cannot make their own food without _____.
1.)cell membranes
2.)cell walls
3.)chloroplasts
4.)vacuoles
C.) Chloroplasts _____.
1.)provide structure and support for plant cells
2.)are also found in animal cells, but they are much smaller
3.)are found inside the mitochondria
4.)allows plants, algae, and certain bacteria to make their own food
D.) Vacuoles are important for _____.
1.) energy production
2.) protection
3.) storage
4.) photosynthesis
E.) Which of the following statements is true?
1.) The rigidity of a cell wall causes plants to be sedentary.
2.) Primary cell walls are more rigid than secondary cell walls.
3.) Since they have cell walls, plant cells do not have cell membranes.
4.) A wilting plant will have a full central vacuole.
F.) Choose all the answers that apply.
Which of the following are only found in plant cells?
1.) cell membranes
2.) chloroplasts
3.) cell walls
4.) vacuoles
Answers
Answer:
A: 3.)attaches plant cells to one another
B: 3.)chloroplasts
C: 4.)allows plants, algae, and certain bacteria to make their own food
D: 3.) storage
E: 1.) The rigidity of a cell wall causes plants to be sedentary.
F: 2.) chloroplasts and 3.) cell walls
Explanation:
I got a 100 on this assignment i know all of these answers are correct
Which compares the problems associated with radioactive waste created from generating electricity using fusion reactions to waste created from generating electricity using fission reactions?
A. The radioactive waste from fusion reactions becomes less hazardous much sooner than the waste from fission reactions.
B. The radioactive waste from fission reactions becomes less hazardous much sooner than the waste from fusion reactions.
C. Although their radioactive wastes are hazardous for the same period of time, fusion reactions produce less waste than fission reactions.
D. Although their radioactive wastes are hazardous for the same period of time, fission reactions produce less waste than fusion reactions.
Answers
Radioactive waste from fusion reactions becomes less hazardous much sooner than waste from fission reactions, nuclear fusion is much safer than fission because it leaves no radioactive waste behind.
What is the difference between the two reactions?Both processes are natural, but they can also be done in a laboratory. While fusion occurs when two atoms are "crushed" to form a single atom of a new element, fission consists of the splitting of an atomic nucleus.
With this information, we can conclude that Radioactive waste from fusion reactions becomes less hazardous much sooner than waste from fission reactions, nuclear fusion is much safer than fission because it leaves no radioactive waste behind.
Learn more about nuclear fusion in brainly.com/question/12701636
#SPJ2
What type of radiation constitutes the basis for setting an SPF rating?
p
Answers
Answer:UV radiation
Explanation:
