GTTCAAGCTACTGTTCAAGCTACT
Match each type of financial institution with its correct description.
Answer:
1. building society
2. trust company
3. asset management firm
4. stock brokerage firm
Explanation:
Please help!!!!!
Can you please help with the first box in the picture.
Answer:
mRNA: UUU/CUU/GUU/AAG/UUU/AAA/GGU/UGA
Amino Acids: Phe/Leu/Val/Lys/Phe/Lys/Gly/STOP
Explanation:
A-U
G-C
T-A
simply means lessen the use of unnecessary materials
Answer:
ok
Explanation:
okokokokokokokkokokok0k0k
Reduce: simply means lessen the use of unnecessary materials.
Waste management can be defined as the processes, schemes, activities and actions that are typically required to collect, treat and manage (handle) a waste material from its creation to its final disposal.
Basically, some importance of waste management are:
I. It makes planet Earth free from garbage or waste materials.
II. It promotes a clean, beautiful and healthful environment.
III. It helps to transform garbage or waste materials into something useful through recycling.
The 5Rs of waste management generally refers to an efficient, effective and modern way of managing garbage and waste material, these include:
Refuse.Reduce.Reuse.Repurpose.Recycle.Reduce is a waste management technique which involves lessening the use of unnecessary materials in the performance of a task.
For example, biodegradable materials can be burned to lessen waste.
Read more: https://brainly.com/question/18769370
Cells that become the _________ undergo a ____________ to __________ transition first. Fill in the blanks.
we the people of the United states in order to form a more perfect union..."what was the purpose of the introduction that begins with these words?
Answer:
The preamble sets the stage for the Constitution, It clearly communicates the intentions of the framers and the purpose of the document. The preamble is an introduction to the highest law of the land; it is not the law. It does not define government powers or individual rights.
Establish Justice is the first of five objectives outlined in the 52-word paragraph that the Framers drafted in six weeks during the hot Philadelphia summer of 1787. They found a way to agree on the following basic principles:
"We the People of the United States, in Order to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defense, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution for the United States of America."
I think.
Explanation:
The football team has a total of 25 jerseys . There are 5 mediums-sized jerseys . What percent of the Jerseys are médium-sized Jersey?
Answer:
20% or 0.2
Explanation:
if u divide 5 by 25, u get 0.2, which in decimal form is 20%
In simple dominance, the dominant trait
a. is masked by the recessive trait
b. masks the recessive trait
Answer:
b. maks the recessive trait
Quick explanation:
The dominant trait masks the reccessive gene, but the person still has the gene, it just won't affect them, it might affect their future generations. For example, the trait for blue eyes is a recessive trait, so in order for you to have blue eyes, both parents will need to have the gene for blue eyes.
NEED HELP ASAP! 100 POINTS!!
A lab experiment is created to see how the amount of solute affects the temperature needed to dissolve the solute completely. 2, 4, 6, and 8 grams of a salt are place in a small test tube with 15mL of water. The test tubes are then heated until the salt completely dissolves. Unfortunately, the test tube with 8 grams of salt never completely dissolves at any temperature. Suggest two changes to the procedure that might solve this problem.
Answer:
Rise the heat and lower the amount of salt
Explanation:
The Convention on Biological Diversity has goals that ________.
a. that ensure the distribution of biodiversity's benefits to wealthy countries who can pay for them
b. that require biodiversity be used in a sustainable manner
c. designed to reduce biodiversity
d. that include a set of international laws
e. spelling out future management plans for all biomes
Answer:
b. that require biodiversity be used in a sustainable manner
Explanation:
The Convention on Biological Diversity is a multilateral treaty that focuses on the use of biodiversity in a sustainable manner. The Convention on Biological Diversity is ratified by 196 nations.
There are majorly three goals of The Convention that include conservation of biodiversity; sustainable use of biodiversity; and equal sharing of genetic resources benefits.
Hence, the correct answer is "b. that require biodiversity be used in a sustainable manner".
When organisms break the bonds of organic compounds the organisms can
Answer:
When organisms break the bonds of organic compounds the organisms can gain energy in the form of ATP.
Explanation:
Which mechanism best describes the process by which nutrients are taken up at the apical surface of the epithelial cells that line the guy and released from their basal and lateral surfaces?
a. Proteins are tethered to the cell cortex
b. Proteins are tethered to the extracellular matrix
c. Protista are tethered to the proteins on the surface of another cell
d. Protein movement is limited by the presence of a diffusion barrier
Answer:
The correct answer is option d. "Protein movement is limited by the presence of a diffusion barrier".
Explanation:
There are transportation mechanisms that allow to take up nutrients to the apical surface of the epithelial cells. The transportation process is best describes as protein movement limited by the presence of a diffusion barrier. There are structures known as tight junctions, located just below the apical surface . These tight junctions acts as diffusion barriers, separating the extracellular fluids surrounding the apical and basolateral membranes.
what would happen to the smooth er if the rough er was broken
The knee ________.
a. is completely enclosed by a strong articular capsule
b. is a multiaxial joint
c. has ligaments present inside as well as surrounding the articular capsule
d. is the simplest joint in the body
Answer:
The correct answer is: C) has ligaments present inside as well as surrounding the articular capsule.
Explanation:
The knee joint is a hinge (ginglymus) type synovial joint that is formed by three different bones: the femur, the tibia, and the patella.
Given the nature of the hinge joint, it should only allow flexion and extension, but it also grants a small degree of internal and external rotation. For this reason, the knee joint cannot be considered a multiaxial joint, since it only fully moves in one axis and slightly moves in a second one (this is why most people consider the knee joint a uniaxial joint, but some others say it is actually a biaxial one).
The knee joint isn't completely enclosed by a strong articular capsule. The knee joint is rather thin and it contains the patella, menisci, bursae, and ligaments of the knee.
The knee is not the simplest joint in the body. It is formed by three bones and there's also the menisci, which are fibrocartilaginous structures that help increase the stability of the joint and act as shock absorbers as well.
The knee does have ligaments both inside and outside the articular capsule. The intracapsular ligaments are two cruciate ligaments (one anterior and one posterior), which hold the tibia in place; the transverse ligament that connects both menisci; and the posterior and anterior meniscofemoral ligaments. The extracapsular ligaments are the patellar ligaments (connects the patella to the tibia), the two collateral ligaments (medial and fibular, one on each side of the knee, connecting the femur to the tibia and to the fibula, respectively), and the anterolateral ligament.
How is the moon involved in the
hydrologic cycle?
B. it helps water evaporate
A. it provides light
C. it cools the Earth
D. it causes tides
Answer:
Explanation:
it cools the Earth
Which compound is a hydrocarbon?
A. C2H6
B.CO2
C. C6H12O6
D. H2O
Sodium is an example of an alkali metal. The alkali metals are found in the leftmost column of the periodic table, known as Group 1. Use the interactive periodic table to explore the properties of the following alkali metals: lithium (Li), sodium (Na), potassium (K), rubidium (Rb), and cesium (Cs). The animations demonstrate a chemical property common to alkali metals: they react with water. How does the reactivity vary among this group of elements? Why might patterns like this be useful to scientists?
Answer:
The reactivity greatens the farther you go down on the periodic table. Lithium will have the weakest reaction, and cesium will have the greatest reaction. Patterns like this are useful to scientists because it shows which elements are the most reactive and which aren't. The farther down and to the left you go within the periodic table, the more reactive the elements become. The farther up and to the right you go, the less reactive they become.
Explanation:
The reactivity of alkali metals increases down the group. Periodic trends help scientists to predict the reactivity of newly discovered elements.
In group 1, reactivity of elements increases down the group because as you go down the group more shells are added thereby making it easier to remove the outermost electron.
This explains the increase in chemical reactivity from Lithium to cesium.
These periodic trends are very important in predicting the chemical reactivity of newly discovered elements that are added to a group.
Learn more: https://brainly.com/question/18153051
Please help fast!!
CELLS: How is the cell membrane different from a cell wall in its structure and
function?
Which type of rock is non-foliated metamorphic rock?
Answer:
slate, phyllite,schist and gneiss
Answer:
Letter A: Gneiss
Explanation:
What conclusion is best supported by the selection above ? NUMBER 2
Answer:
Arginine and Lysine play same role in membrane proteins.
Explanation:
The scientist have tested Lysine and Arginine to get information about their properties. The test lead to conclusion that both are amino acids which are high in aqueous values which lead to high electrostatic interaction. These amino acids play important role in membrane proteins.
it helps to promoting growth of roots and absorption of nutrients.
Answer:oil is a major source of nutrients needed by plants for growth. The three main nutrients are nitrogen (N), phosphorus (P) and potassium (K). Together they make up the trio known as NPK. Other important nutrients are calcium, magnesium and sulfur.
Many chemical reactions take place in living things. All chemical reactions have a certain amount of energy that must be supplied in order to make the reaction begin. This is called
Answer:
Activation energy...!
Explanation:
We could tell by the rotten smell, that something putrid was in our trash can
Explain the word putrid
A ample
B alive
C Rotten
D appealing
Answer
The answer is c
Explanation:
Really Need This >:3
A
B
C
Answer:
I'm pretty sure it's A
Explanation:
To compress means to push together. I hope this helps
What is the maximum magnification of most classroom compound light microscopes?
O 100x
O 500x
O 1,000x
O 5,000x
Answer:
C. 1,000x
Explanation:
Answer: 1000x c
Explanation:
Please I need a comparison table between plant cells and plant tissues
Answer:
Plant tissues are collections of similar cells performing related functions. Different plant tissues will have their own specialized roles and can be combined with other tissues to form organs such as flowers, fruit, stem, and leaves. Two major types of plant tissue include meristematic and permanent tissue.
Meristematic tissue, the primary growth tissue in plants, is capable of self-renewal and indefinite cell division. Every cell in the plant originates from a meristem. Meristematic tissue is classified into one of three types depending on its location inside the plant - apical, lateral, and intercalary. Apical meristems are meristematic tissue located at the tip of root and stem, which enable elongation of plant length. Lateral meristems are present in the radial portion of the stem and root and increase the thickness or girth of the maturing plant. Intercalary meristems occur only in monocots at the base of the internode and leaf blade. The intercalary meristems increase the length of the leaf blade.
Explanation:
I CAN TELL UPTO THIS MUCH.
I HOPE THIS ANSWERS HELPS.
THANK U!
Which of these is describing a Eutrophic Lake?
Mucky Water
Cold Water
Low Biodiversity
Rocky Bottomed
Plz answer I need help thank you
Answer:
Mucky water and rocky bottom
Answer:
mucy water ..........
Which two factors are responsible for seasons on Earth?
A. Greenhouse gases and ozone in the atmosphere
B. Earth's tilted axis and its rotation around it
C. Trade winds and sea breezes
D. Earth's tilted axis and its revolution around the sun
Answer:
D
Explanation:
The short explanation is how the earth is tilted towards the sun, and it's revolution will cause certain parts to be closer or farther relatively to the sun. Hope this helps
The change in season is brought on by the earth's tilted axis and its revolution around the sun. Therefore, option (D) is correct.
The seasons are caused by Earth's tilted axis. Different regions of the Earth are exposed to the Sun's strongest rays at various times of the year. Therefore, the Northern Hemisphere experiences summer when the North Pole tilts toward the Sun. Additionally, winter in the Northern Hemisphere occurs when the South Pole tilts toward the Sun.
The Northern Hemisphere experiences summer in June because the Sun shines more intensely there than at any other time of the year. The Northern Hemisphere experiences winter in December because it is the month when the South Pole is oriented toward the Sun.
Therefore, option (D) tilted axis and revolution are reasons for the seasons.
Learn more about seasons, here:
https://brainly.com/question/923847
#SPJ5
what is the last thing that happens when a cell divides to produce two new identical cells
Answer:
The last phase of cell division is cytokinesis. In this phase the cytoplasm of parent cell divides in to two cells called as daughter cells. It occurs during late stages of nuclear division.
The visible change of cytokinesis in an animal cell can be observed as formation of Furrow or Pucker on the cell surface.
I've had my cat for three years. In that time she's gained half a pound. Explain the origin of her increased mass and whether atoms are still the same atoms as when she consumed them.
The buring of fossil fuels releases which of the following gases into the atmosphere
