In 1991, a complex collection of political, economic and social factors precipitated an unsuccessful coup to depose the eventual last leader of the Soviet Union, Mikhail Gorbachev.
What events led to the attempted coup to overthrow Mikhail Gorbachev in 1991?Economic Struggles: During the late 1980s and early 1990s, citizens across the nation were confronted with continual dearth of essential commodities, rampant inflation and waning productivity – all accompaning features of a major crisis in the Soviet economy. Such alarming conditions gave rise to deep discontent within the population as well as among select sectors of the ruling mastermind.
Arduous Reforms: In order to address such issues, Gorbachev devised a series of reforms such as perestroika (reconstruction) and glasnost (openness), meant to relax state control and encourage extra diversification in the political arena. Nonetheless, the revolutionary strategies were met with much hostility from conservative elements of the Communist Party and military forces, who viewed these movements as posing grave risks to stability of the Soviet regime.
Separatist Agitations: The country consisted of several diverse ethnic groups; accordingly, separatist agitation for enhanced local liberty or outright secession had transpired in a multitude of its constituent republics. This perturbed those dedicated to maintaining national unity and integrity.
The coup ultimately failed for several reasons:
Lack of popular support
Diviison in the military
Read more on Mikhail Gorbachev herehttps://brainly.com/question/1286817
#SPJ1
THIS IS an antisense ATGCGGAATTGGCGACATAA , Write the nucleotide sequence that would be translated from this strand of DNA?
The nucleotide sequence that would be translated from this strand of DNA is ATCGCTTAGAACCGCATTCTT.
Nucleotide sequence is a string of nucleotides, which are the basic units of genes and genetic information. Nucleotides are made up of three parts: a phosphate group, a sugar molecule (deoxyribose), and a nitrogenous base.
The nitrogenous bases come in four different types—adenine (A), guanine (G), cytosine (C), and thymine (T). Every gene consists of an ordered sequence of these four bases. Different sequences of these compositions determine the physical characteristics expressed by an organism.
To know more about nucleotide sequence visit:
https://brainly.com/question/17105264
#SPJ4
how did the erie canal affect the american industrial revolution?
Answer: helped facilitate access to coal reserves in Pennsylvania, reducing American dependence on imported coal
Explanation:
37) The border between Germany and Poland established after World War II
The border between Germany and Poland established after World War II, known as the Oder-Neisse Line, was an outcome of the Potsdam Conference held in 1945.
The conference was attended by the leaders of the Allied Powers, including the United States, the United Kingdom, and the Soviet Union, to determine the future of Germany and its territories.
At the Potsdam Conference, it was decided that Germany would be divided into four occupation zones, and its eastern territories would be ceded to Poland and the Soviet Union. The Oder-Neisse Line, named after the two rivers Oder (Odra) and Neisse (Nysa), was proposed as the new border between Germany and Poland. This border shift aimed to compensate Poland for its territorial losses to the Soviet Union in the east.
The Oder-Neisse Line was a contentious issue, as it resulted in the displacement of millions of Germans living in the territories given to Poland. The new border was initially a provisional one, and it wasn't until the 1970 Treaty of Warsaw between West Germany and Poland that it was officially recognized. Finally, with the reunification of Germany in 1990, the border was confirmed as permanent in the German-Polish Border Treaty.
In summary, the Oder-Neisse Line established the border between Germany and Poland after World War II, following the decisions made at the Potsdam Conference. It remains the border between the two countries to this day, after being officially recognized in multiple treaties.
For more about World War II:
https://brainly.com/question/13382356
#SPJ11
What was the one major advantage that allowed the small Portuguese fleet to dominate the Indian Ocean militarily?
The one major advantage that permitted the little Portuguese armada to rule the Indian Sea militarily Their installed gun could overcome different boats and beachfront fortifications.
Europeans had found the subtle water course to the rewarding Indian Sea exchange organization. The Portuguese technique in the Indian Sea was to overwhelm exchange using capability, terrorizing, and ruthlessness. their boats could outgun and outsmart contending maritime powers.
Their boats could outgun and outsmart contending maritime powers, while their installed cannons could annihilate beachfront fortresses. The point of Portugal in the Indian Sea was to guarantee the imposing business model of the flavor exchange.
Learn more about Portuguese:
https://brainly.com/question/31344706
#SPJ4
why were many abolitionist groups an extension of the church
The reason why many abolitionist groups serves as an extension of the church was that some of the Enlightenment philosophers opposed slavery and most of them are Christian activists.
What was abolitionist groups?The groups can be described as the fragmented anti-slavery movement which were been set up so they can come against the act of slavery they some of the group which can be seen as the Liberty Party; the American as wellas the Foreign Anti-Slavery Society.
Itshould be noted that the American Missionary Association as wellas other group rised up so that they can come against this and some of them are Christian activists.
Learn more about abolitionist at:
https://brainly.com/question/1818846
#SPJ1
Which Egyptian Royalty commissioned a Mortuary Temple Designed by Senmut?
The temple was commissioned by Hatshepsut. Its building was probably overseen by Senenmut, her trusted advisor who some researchers speculate may have also been her lover.
A mortuary temple constructed during the rule of Pharaoh Hatshepsut of Egypt's Eighteenth Dynasty is known as the Hatshepsut funerary temple. It is regarded as a marvel of ancient architecture and is situated across from the city of Luxor.
The whole construction pointed in the direction of the imposing Eighth Pylon, which Hatshepsut added to the Temple of Karnak as her most known work and from which the procession of participants of the Beautiful Festival of the Valley departed.
Learn more about Mortuary Temple here:
https://brainly.com/question/31182497
#SPJ4
TRUE OR FALSE : the Paleozoic Era is longer than the Neoproterozoic Era.
TRUE. The Paleozoic Era, which lasted from approximately 541 million years ago to 252 million years ago, is longer than the Neoproterozoic Era, which lasted from approximately 1 billion years ago to 541 million years ago.
The earliest of the three (3) geologic eras that made up the Phanerozoic era is referred to as the Paleozoic era.
Because it began 541 million years ago and concluded 252 million years ago, the Paleozoic era is widely regarded as the Phanerozoic era's longest geologic era. The Paleozoic era is divided into six geologic periods, which are given below in order of oldest to youngest:
between the beginning and conclusion of the Paleozoic era, the following events occurred;
Marine living organisms (phyla) were present throughout the Cambrian period of the Paleozoic era.There was volcanic activity during the Paleozoic era.Finally, the Paleozoic epoch was a time in geologic history when marine fossils were subject to erosion and deposition.Learn more about Paleozoic Era here
https://brainly.com/question/11614266
#SPJ11
Safety net programs include…
Why do you think the Quakers and others on the Underground Railroad provide shelter to the runaways?
A. They help for humanitarian and religious reasons.
B. They are Northerners who are against Southerners.
C. They like Harriet Tubman.
D. They wanted to gain political advantage in the North.
The Quakers and others on the Underground Railroad provided shelter to runaway slaves for (Option A) humanitarian and religious reasons, not for political gain or personal preferences.
The Quakers, a religious group that believed in the equality of all human beings, felt that it was their moral duty to help those who were oppressed and suffering.
Additionally, the Underground Railroad was not a political organization, but a network of people who were dedicated to helping slaves escape to freedom.
Those who participated in the Underground Railroad did so at great personal risk, as it was illegal to aid runaway slaves. Therefore, it is unlikely that they would have risked their safety for political gain or personal preferences.
Furthermore, the Underground Railroad was not solely operated by Northerners who were against Southerners. It was a network of people who shared a common goal of helping slaves escape to freedom.
While there were certainly individuals in the North who were against slavery and supported the abolitionist movement, the Underground Railroad was made up of people from all walks of life and from various regions of the country.
In conclusion, the Quakers and others on the Underground Railroad provided shelter to runaway slaves out of a sense of (Option A) humanitarianism and religious duty, not for political gain or personal preferences.
They believed in the equality of all human beings and were willing to risk their own safety to help those who were oppressed and suffering.
For more question on "Quakers" :
https://brainly.com/question/23938089
#SPJ11
in 1890, the sherman anti-trust act was enacted. what was it's purpose, and how did it effect organized labor?
In 1890, the Sherman Anti-Trust Act was enacted. Its primary purpose was to regulate and prevent monopolistic practices by large corporations, as well as to promote economic competition. This legislation aimed to prohibit trusts, cartels, and other business arrangements that could potentially hinder fair competition within the marketplace.
The impact of the Sherman Anti-Trust Act on organized labor was significant. Initially, the Act was not only used to target big corporations, but it was also applied to labor unions. Courts often viewed unions as potential restraints on trade, as they could limit the supply of labor and drive up wages.
Consequently, unions were sometimes prosecuted under the Act, which led to the weakening of the labor movement during this period.
However, as the interpretation of the Sherman Anti-Trust Act evolved over time, its application to labor unions diminished. In 1914, the Clayton Antitrust Act was passed, which explicitly exempted labor unions from being considered as monopolies or illegal combinations.
This allowed organized labor to regain strength and continue advocating for better working conditions and wages for their members.
In conclusion, the Sherman Anti-Trust Act of 1890 was enacted to prevent monopolistic practices and promote competition. Initially, its impact on organized labor was negative, as unions were prosecuted under the Act.
However, with the passage of the Clayton Antitrust Act in 1914, unions were exempted from the law, allowing them to continue fighting for workers' rights.
To know more about monopolistic practices refer here
brainly.com/question/12652861#
#SPJ11
Describe some ways in which the Taliban soldiers destroy Kabul
The Taliban soldiers destroy Kabul by swarming the dilapidated Kabul museum and smashed pre-Islamic statues to rubble.
The Taliban, which also calls itself the Islamic Emirate of Afghanistan due to the name of its country, is a radical political movement of Deobandi Islamic fundamentalism and Pashtun nationalism in Afghanistan. He ruled three-quarters of the country from 1996 to 2001 before being overthrown after the US invasion. He recaptured Kabul on August 15, 2021, after nearly 20 years of insurgency, and currently controls the entire country, although his government is not recognized by any country. The Taliban government has been criticized for restricting women's and girls' human rights, including their right to work and education, in Afghanistan.
To know more about Taliban click on the link below.
brainly.com/question/12326725
#SPJ4
They made farmers devote valuable land to cash crops like cotton and tried to compile subsistence farmers to modernize by charging them taxes What are the cons of colonial powers?
The cons of colonial powers include exploiting native resources, forcing cash crops on farmers, imposing taxes, subjugating the local population, erasing native culture and identity, and creating a legacy of inequality and instability.
Colonial powers often saw their colonies as sources of raw materials and labor to fuel their own economies. This resulted in the exploitation of native resources and people, with little regard for their welfare. Colonial powers also forced farmers to grow cash crops like cotton, which depleted the soil and reduced food security.
Furthermore, colonial powers imposed taxes on the local population, which often led to economic hardships and social unrest. The imposition of taxes was often part of an effort to modernize the local population and create a more efficient system of governance.
Finally, colonial powers eroded native culture and identity through policies of assimilation and cultural domination. This created a legacy of inequality and instability that still affects many former colonies today.
Learn More about colonial powers :
https://brainly.com/question/14447948
#SPJ4
TRUE OR FALSE 86) Colonialism is an effort by one country to establish settlements and impose its political, economic, and cultural principles on an alien people.
The given statement "colonialism is an effort by one country to establish settlements and impose its political, economic, and cultural principles on an alien people" is true, because it results in the loss of native culture and political autonomy, while benefiting the colonization of country economically.
This practice has been historically prevalent, with countries expanding their territories by establishing colonies in other regions. The colonizing country often seeks to exploit the resources of the colonized region, while also imposing their political system, economic structure, and cultural values upon the local population.
Colonialism often involves the suppression of the native culture and the promotion of the colonizer's culture. This can result in significant changes to the social and political structures of the colonized society.
The colonizing country typically benefits economically from the exploitation of resources and labor, while the colonized people may face long-term disadvantages due to the loss of sovereignty and self-determination.
In summary, the statement is true: colonialism is the process by which one country seeks to establish settlements in another region and impose its political, economic, and cultural principles on the native people.
This practice has had profound and lasting effects on the societies involved, often resulting in the loss of native culture and political autonomy, while benefiting the colonization of country economically.
To know more about colonization, refer here:
https://brainly.com/question/30764395#
#SPJ11
Give a definition or explanation of greenstone belts and include the age of the oldestknown greenstone (or supracrustal) belt.
Greenstone belts refer to geological formations that consist of primarily volcanic rocks and sedimentary rocks that have undergone intense metamorphism. The Isua Greenstone Belt is the oldest known greenstone belt, dating back approximately 3.8 billion years.
These belts are typically found in Archean and Proterozoic rock sequences, and they are believed to have formed during periods of active tectonic activity and volcanic eruptions.
Greenstone belts are important as they often host economically significant mineral deposits, such as gold, silver, and copper. These belts also provide valuable insight into the early evolution of the Earth's crust and the processes that led to the formation of continents.
The oldest known greenstone belt is the Isua Greenstone Belt in southwest Greenland, which has been dated to be approximately 3.8 billion years old. This belt is believed to have formed during the early stages of the Earth's formation and provides important clues about the conditions that existed on the planet during that time.
In summary, greenstone belts are geological formations composed of primarily volcanic and sedimentary rocks that provide valuable insights into the early evolution of the Earth's crust and host economically significant mineral deposits. The Isua Greenstone Belt is the oldest known greenstone belt, dating back approximately 3.8 billion years.
For more about Greenstone belts:
https://brainly.com/question/31322244
#SPJ11
How and why did employer-employee relationships change during the Industrial Revolution?
Relationships change during the Industrial Revolution as foundation of huge plants obliterated those immediate connections, offering proprietors less chance to lay out an individual interest in laborers.
The Industrial Revolution changed economies that had been founded on horticulture and handiwork into economies in view of enormous scope industry, motorized assembling, and the manufacturing plant framework. Existing industries were made more productive and efficient by new machines, new power sources, and new ways to organize work. Opportunities for employment increased as a result of the Industrial Revolution.
Compared to what farmers were earning, factory wages were higher. As factories spread, more managers and workers were needed to run them, which led to an increase in the number of jobs available and overall wages.
Learn more about Industrial revolution :
brainly.com/question/13323062
#SPJ4
Why was the early Chinese writing important for the Chinese
The early Chinese writing system was important for the Chinese because it was the foundation of their culture and communication.
What is culture ?Culture is the practices, beliefs, values, and behaviors that make up the unique identity of a group of people. It is the way of life shared by a particular society or population, and can include language, customs, values, norms, and traditions. Culture shapes how people interact with one another and the world around them, and it is constantly evolving and adapting in response to changes in the environment. It involves everything from the way people dress and speak, to their diets and religious beliefs. It also includes ideas, stories, and art that are created and shared by the members of the culture. Ultimately, culture is the collective identity of a group of people and is an important part of human experience.
To learn more about culture
https://brainly.com/question/29285761
#SPJ1
Answer: early Chinese writing was essential for the preservation of culture, communication, governance, and the development of a shared cultural identity
Explanation:
The Harappan Civilization was the first to build with what material?
Answer:
Harappan objects were made of stone, Shell, and metal. Copper and bronze were used to make tools, weapons, ornaments, and vessels. Gold and silver were used to make ornaments and vessels. Harappans also made stone seals.
Which statement about Joan of Arc is true?
Responses
Option B is one that accurately describes Joan of Arc, she said that she had received command from God to lead French troops in combat with English invaders.
Who is Joan of Arc?Joan of Arc, also known as the Maid of Orleans, was a French national heroine who played a pivotal role during the Hundred Years' War between England and France. Born in 1412 in Domrémy, France, she claimed to have received visions from God instructing her to lead the French army to victory against the English. At the age of 17, she convinced the French Dauphin to allow her to lead the army and she subsequently won several key battles, including the lifting of the siege of Orleans. She was found guilty and burned at the stake in 1431, but was later exonerated by the Catholic Church and canonized as a saint in 1920.
Learn more about Joan of arc here,
brainly.com/question/497316
#SPJ1
Complete Question:
Which statement about Joan of Arc is true?
A. She was a Benedictine nun who predicted that France would fall to King Edward III.
B. She said that God had told her to lead French troops against the English invaders.
C. She was executed by King Charles of France for losing the Battle of Crecy.
D. She commanded English forces in a siege against the French city of Orléans.
8) How free were Americans (in particular, women, African-Americans, and Japanese-Americans) in the years before and during World War II? To answer this question, you should use the Four Freedoms—as defined by the President and Norman Rockwell—as the standard.
Many Japanese Americans were forced to live in poor, cramped circumstances with barbed wire fences around them and armed guards for many years.
Japanese Americans lost not only their homes, companies, property, and money but also their liberty, security, and fundamental liberties that are equally the property of all Americans. I have always held the opinion that great countries confront their most trying times head-on, learn from them, and become stronger as a consequence.
The imprisonment of Japanese Americans 80 years ago serves as a warning to us about the awful results we invite when we let racism, xenophobia, and other forms of bigotry thrive.
Learn more about Japanese Americans here:
https://brainly.com/question/14585867
#SPJ4
Economists call the constant ____ of the economy "creative destruction"
Economists refer to the constant transformation of the economy as creative destruction.
This concept was first introduced by Austrian economist Joseph Schumpeter in 1942. Creative destruction refers to the process through which innovative and technologically advanced ideas, products, and processes replace outdated ones, leading to economic growth and development.
In the context of the economy, creative destruction occurs when new technologies, products, or methods of production are introduced, making older ones obsolete. This process can result in the disappearance of certain industries or companies while creating new ones in their place.
Despite the potential negative impact on specific sectors or businesses, creative destruction is considered an essential driver of long-term economic growth and improved standards of living.
1. Innovation and technological advancements are introduced in the market.
2. These advancements lead to increased efficiency and productivity.
3. As a result, older technologies, products, or methods of production become obsolete and less competitive.
4. Companies and industries using the outdated technologies either adapt to the changes or face decline and potential closure.
5. New industries and companies emerge in response to the new technologies and market demands.
6. The process continues, constantly reshaping the economy and driving economic growth.
In conclusion, creative destruction is a vital aspect of a dynamic and evolving economy, ensuring continuous progress and development through the constant transformation of industries, products, and processes.
To know more about creative destruction, refer here:
https://brainly.com/question/28188575#
#SPJ11
What provision did New York City make for its homeless in the early 1870s?
In the early 1870s, New York City made provisions for its homeless population by establishing temporary shelters and aid programs. These provisions aimed to provide basic necessities like food, clothing, and a place to sleep for the city's homeless individuals.
In response to the growing homeless population, New York City opened up shelters, also known as "lodging houses," to provide temporary housing for those in need. These lodging houses were often supported by philanthropic organizations and religious institutions that provided funding and resources to help the city's homeless population.
In addition to lodging houses, aid programs were established to offer food and clothing to homeless individuals. "Soup kitchens" and charitable organizations distributed essential items to those in need.
Job placement services were also created to help homeless individuals find employment and eventually transition to stable housing.
In summary, New York City made several provisions for its homeless population in the early 1870s, including establishing temporary shelters, aid programs for food and clothing, and job placement services. These measures aimed to alleviate the struggles the city's homeless individuals faced and help them regain stability in their lives.
To learn more about homelessness, visit: https://brainly.com/question/31607626
#SPJ11
What can you tell me about the context and the style of Repos d'amour?
"Repos d'amour" is a painting by the French Rococo artist Jean-Honoré Fragonard, created around 1771-1773. The painting depicts a young couple resting in a landscape, surrounded by lush vegetation and flowers.
In terms of style, "Repos d'amour" is a quintessential example of the Rococo style. Rococo is characterized by its ornate and playful decorations, as well as its light and delicate brushwork.
The style emerged in France in the early 18th century, and was associated with the French court and aristocracy.
"Repos d'amour" is notable for its use of pastel colors and soft brushwork, which create a dreamy and romantic atmosphere.
The landscape is depicted in a hazy and almost abstract manner, with the emphasis placed on the couple in the foreground.
The woman is shown lying on her back, with her head resting on her lover's lap, while he leans over her and gazes down at her.
In terms of context, "Repos d'amour" was created during a time of great political and social upheaval in France. The painting was created just a few years before the French Revolution, which would overthrow the French monarchy and transform French society.
The Rococo style, which had been associated with the French court and aristocracy, would fall out of favor during the Revolution, as the new regime favored a more austere and classical style.
Despite this, "Repos d'amour" remains a beloved example of the Rococo style, and continues to be admired for its beauty and charm.
to know more about French Rococo refer here:
https://brainly.com/question/28260986#
#SPJ11
In two sentences, explain why people support and oppose new voting rules that some state legislatures have made in the United States.
Thank you!! :)
All of the following were important patrons of Dutch seventeenth century art EXCEPTA. popesB. guildsC. private individualsD. civic organizations
Popes did not play a significant role in the patronage of Dutch seventeenth-century art, as the Netherlands was a Protestant country and there was little contact between the Dutch artists and the papacy. The correct option is A.
The Dutch Golden Age, a period of economic and cultural prosperity in the Netherlands during the seventeenth century, saw a flourishing of artistic production, particularly in painting.
During this time, many patrons played an important role in supporting artists and commissioning artworks.
Among the most prominent were private individuals, who were often wealthy merchants, nobles, or members of the bourgeoisie.
They commissioned paintings for their homes or as gifts, and their tastes and preferences helped shape the direction of Dutch art.
Guilds, and associations of craftsmen, also played a significant role, commissioning artworks for their headquarters and sponsoring competitions and exhibitions.
Civic organizations such as city governments, churches, and hospitals were also important patrons of art, commissioning works for public spaces or as part of religious or civic ceremonies.
to know more about Patronage of Dutch refer here:
https://brainly.com/question/12881231#
#SPJ11
even in the north which group was a regular part of commerce linking north american, africa, and europe? group of answer choices skilled craftsmen and shopkeepers sons of wealthy gentry university-trained puritans slaves and indentured servants
The group that played a regular part in commerce linking North America, Africa, and Europe, even in the North, was the "slaves and indentured servants." The correct option is slaves and indentured servants.
This group was an essential component of the transatlantic trade system known as the Triangular Trade. This system involved the trade of goods, raw materials, and people among the three continents. The main components of the Triangular Trade were the exchange of manufactured goods from Europe for enslaved people from Africa, who were then transported to North America and the Caribbean.
Though slavery and indentured servitude were more prevalent in the Southern regions of North America, they were still present in the North, contributing to the commercial success of the region. The Triangular Trade enabled merchants in the North to profit from the sale of goods and raw materials, fostering economic growth and development.
In summary, slaves and indentured servants played a significant role in commerce that linked North America, Africa, and Europe, even in the northern regions. They were an essential part of the Triangular Trade system, which facilitated economic growth and prosperity throughout the colonies. The correct option is slaves and indentured servants.
For more about indentured servants:
https://brainly.com/question/4850869
#SPJ11
Where did the Germans mostly immigrate in the American colonies?
Answer:The central colonies
Explanation:the greatest part of this immigration, especially Pennsylvania. As many as half of these immigrants came as redemptioners, that is, they agreed to work in America for four to seven years in exchange for free passage across the Atlantic.
What did King Louis XVI of France offer the Americas?
King Louis XVI of France offered: significant financial and military support to the Americas during the American Revolutionary War.
In response to your question about what King Louis XVI of France offered the Americas, the key terms to consider are King Louis XVI, France, financial support, military support, and American Revolutionary War.
King Louis XVI saw an opportunity to weaken Britain, a rival nation, by assisting the American colonies in their struggle for independence. After the American victory at the Battle of Saratoga in 1777, France entered into a formal alliance with the Americans.
This alliance, known as the Treaty of Alliance, provided the colonists with vital financial support, as France loaned money and supplied weapons, ammunition, and uniforms to the American forces.
Additionally, France offered military support in the form of troops, ships, and experienced officers. One notable figure who served as a volunteer was the Marquis de Lafayette, who played a crucial role in the war as a key aide to General George Washington.
French naval forces, under the command of Admiral de Grasse, also played a decisive role in the American victory at the Battle of Yorktown in 1781.
In summary, King Louis XVI of France offered financial and military support to the Americas during the American Revolutionary War. This support was essential in helping the colonists achieve victory and ultimately secure their independence from Britain.
To know more about Revolutionary War, refer here:
brainly.com/question/22135298#
#SPJ11
Why was Nigeria formerly under a command economic system?
Nigeria formerly operated under a command economic system because type of centrally planned economy.
This system was implemented in the 1960s when Nigeria gained independence from Britain. The main goal of the command economic system was to reduce income inequality and promote industrialization. Under this system, all production and pricing decisions were made by the government.
The government would control all imports, exports, and foreign investment. It would also determine wages and prices for goods, as well as regulate all business activities. This system ultimately failed due to corruption and lack of incentives for producers, leading to an inefficient economy with high levels of poverty.
To know more about command economic system visit:
https://brainly.com/question/28423244
#SPJ4
About how long did the Portuguese trading empire in the Indian Ocean flourish?
The Portuguese trading empire in the Indian Ocean flourishes in Less than a century.
The option (B) is correct.
Portugal's motivation in the Indian Sea was to guarantee the imposing business model of the zest exchange. Exploiting the contentions that set Hindus in opposition to Muslims, the Portuguese laid out a few fortresses and general stores. By 1600, the Portuguese general store realm started by Vasco da Gama in 1497 was at that point in steep downfall.
The Indian Ocean was the focal point of world exchange. A wide range of shipping lanes crossed its waves. These courses connected the South China Ocean to the Indian Sea to the Mediterranean Ocean.
Learn more about trading empire:
https://brainly.com/question/2574969
#SPJ4
This question is not complete, Here I am attaching the complete question:
About how long did the Portuguese trading empire in the Indian Ocean flourish?
a) Nearly four centuries
b) Less than a century
c) Less than 50 years
d) About two centuries
How did the familiars of the Inquisition get answers from the people they questioned?
Answer questions 6, 7, and 8 below as well *
**PROVIDE CLEAR ANSWER**
WILL GIVE BRAINLIEST AS WELL
The familiars of the Inquisition get answers from the people by making their presence known, allowing locals the chance to confess their sins.
Confessions were punished with anything from a beating to a pilgrimage. Those who were suspected of heresy were made to testify.
This is the way they got answers from the people they questioned.
6. What happened to people in Spain who continued to practice Judaism?
- Jews, Muslims, and Protestants in Spain were forced into conversion, banished from Spain, or put to their end.
The Inquisition extended to further regions of Europe and the Americas. Hence, the people in Spain were treated cruelly.
7. How did Rifqa's family respond to inquisition ?
-In response to the Inquisition, Rifqa, her parents, and her brothers Nathan and Saul fled to Russia in an effort to join the three elder boys who had been residing in America.
8. You have learned about the history of Iberian Peninsula in multiple lessons. Using what you have learned, explain the major issues and the surrounding environment that created these issues. Be sure to include people, events and important dates in your explanation.
- Some major issues with Iberian peninsula are-
Iberia is one of the regions in Europe most likely to suffer severely from extreme climate change in industries that directly depend on precipitation and warmth, such agriculture and water supply.
- According to a case study, some of the issues that were highlighted were-
Water availability: By 2071-2100, it is expected that all scenarios in the Tagus River basin would result in a major decline in water availability, which will make it harder to comply with the Albufeira Convention on water sharing between Spain and Portugal.Energy accessibility: By the end of the century, hydropower generation may have decreased by 45–50%. The Segura River's water supply will be drastically reduced, and it won't be able to keep up with demand, especially under the more extreme climate change scenarios.Opportunities and threats: By changing reservoir management, implementing an environmentally conscious water management strategy, and significantly reducing the amount of water supplied to the Segura River transfer.Some major events that affected Iberia-
A Germanic invasion of the Iberian Peninsula in 406 included the Vandals, Swabians, and Alans, an Iranian-born non-Germanic group who had joined the Vandals. The invaders reached the west coast in less than two years.Iberia's history was dominated by Muslim rule from the early eighth century until the late fifteenth century, despite Christian attempts to retake governmental control of the peninsula. Early Portuguese growth was fueled by a stable monarchy by the fifteenth century. The union of Isabel and Fernando in Spain in 1479 was a crucial turning point in the creation of modern Spain. The contemporary states of Spain and Portugal are a result of those events. The first European state was Portugal.To know more about The Inquisition visit:
https://brainly.com/question/22445626
#SPJ1