what does Chiaroscurist mean

Answers

Answer 1

Answer:

Chiaroscurist means a painter who uses light and shade rather than color to add more of an illusion. (Whether this be 3D or realistic type of an illusion.)

Explanation:

You will learn this in an art class.


Related Questions

me trying to help people but dont know anything they asking;-;

Answers

POV

Sends a math question about angles and doesn’t put in a photo.

Which antonym helped you determine the meaning of
callous?

Tender

Answers

Answer:

Tender

Explanation:

Answer:

Explanation:

Soft

What is the meaning of the phrase "a mirror reflecting a person's life in reference to the afterlife in the Newselsa article "How Ancient
Egyptians Shaped the World's View of Life After Death?
O It helps people reflect on their lives on earth
O It imitates a person's life on earth
It has a window for viewing life on earth,
It is more pleasant and rewarding than life on earth.
Fo

Answers

Answer:

it imitate a person's life on earth

Explanation:

your question is not correct

has anyone else ever been in a situation were you just want to have a conversation but it ends up being you talking to yourself because they just dont care to answer back? :(

Answers

Answer:

Yes, all the time, I feel for you. Have a great day and week

Explanation:

yk all the time, it just gets lonely

I have to put this quote in my own words Need help!
-"Suspicion kissed you when I did. I never knew how I should say, my love. It were a cold house I kept!" Crucible act 4

Answers

from reading and understanding the context of the passage, Elizabeth is telling her husband that she isn’t feeling him anymore to simply put it. She’s saying that she never knew how to tell him that she doesn’t feel the same love anymore and things have changed quite a bit.

hope this helps!

How would you characterize the tone of the following sentence: "I won the game fair and square- and I'll fight anyone who says differently!"

bored

angry

deceitful

delighted

Answers

Answer:

I would say angry.

Explanation: Deceitful is the only other one that makes sense, and deceitful   means untruthful. I hope this helps!

Sentence with instruct in it please!

Answers

Explanation:

Grandma will instruct me on how to make pie using the family recipe so I can share it with my children. 

In at least 150 words write a summary of serve the people

Answers

Answer:

"Serve the People" talks about the duty to serve and to save the suffering Chinese citizens. It also talks about how there is sacrifice when there is struggle and that dying while serving the people is a worthy death. According to the text, it states, "But we have the interests of the people and the sufferings of the great majority at heart, and when we die for the people it is a worthy death." This tells the readers that dying for the people is worth it and will get the recognition of the people. It also talks about how anybody that has done something useful dies, either a soldier or a cook, that they should have a proper funeral ceremony as well as a memorial meeting in the presence of their honor. Based on what I read, "This should become the rule. And it should be introduced among the people as well. When someone dies in a village, let a memorial be held." This tells the readers that they care about the people and that this is a way in which they express their mourning for the dead and to unite all the people.

Summarize chapter 6 of sacred clowns
Need this ASAP

Answers

The 6 Saracen clowns stereo den

Which of the following BEST states the main idea of the text

Answers

Answer:can i see the question i cant see it

Explanation:

Which adjective best describes work on a sugar plantation in the 1600s and 1700s?
A. harmless
B. dangerous
C. simplistic
D. uneventful

Answers

Answer:

b

\

Explanation:

Answer: B

Explanation:Just took the test and got it correct

it's controlled room. Unauthorized person's_____come inside.

A.don't have to B.can't C.can D.wouldn't​

Answers

Answer:

B.

Explanation:

Leander was a youth of Abydos, a town of the Asian side of the strait [narrow ocean channel] which separates Asia and Europe. On the opposite shore, in the town of Sestos, lived the maiden Hero, a priestess of Venus. Leander loved her, and used to swim the strait nightly to enjoy the company of his mistress, guided by a torch which she reared upon the tower for the purpose. But one night a tempest arose and the sea was rough; his strength failed, and he was drowned. The waves bore his body to the European shore, where Hero became aware of his death, and in her despair cast herself down from the tower into the sea and perished. Source: Bulfinch, Thomas. "Hero and Leander." Project Gutenberg. Project Gutenberg, 27 Mar. 2002. Web. 25 Feb. 2011.

Answers

Hello. This question is incomplete. The full question is:

Leander was a youth of Abydos, a town of the Asian side of the strait [narrow ocean channel] which separates Asia and Europe. On the opposite shore, in the town of Sestos, lived the maiden Hero, a priestess of Venus. Leander loved her, and used to swim the strait nightly to enjoy the company of his mistress, guided by a torch which she reared upon the tower for the purpose. But one night a tempest arose and the sea was rough; his strength failed, and he was drowned. The waves bore his body to the European shore, where Hero became aware of his death, and in her despair cast herself down from the tower into the sea and perished. Source: Bulfinch, Thomas. "Hero and Leander." Project Gutenberg. Project Gutenberg, 27 Mar. 2002. Web. 25 Feb. 2011.

Which archetype fits the character of Hero best?

the Ingènue

the Hero

the Villain

the Lady Warrior

Answer:

the Ingènue

Explanation:

Archetype is a model of something, a prototype, a kind of example about certain characteristics and behaviors. Archetypes show how a hero and a villain should act, or how shy and romantic people should act, for example.

In the text shown above, we can see that the hero has the Ingènue archetype, which is characterized by being a model of a young, innocent, kind, beautiful, gentle, loving and virginal girl.

Answer:

A.) the Ingènue

Explanation:

edge 2021

Tell me the tone of the following passage from 'The Tell-Tale Heart" by Edgar Allen Poe
"It was A LOW, DULL, QUICK SOUND - SUCH A SOUND THAT A WATCH MAKES WHEN ENVELOPED IN COTTON. I gasped for breath, and yet the
officers heard not. I talked more quickly, more vehemently but the noise steadily increased. I arose and argued about trifles, in a high key and with violent
gesticulations; but the noise steadily increased. Why WOULD they not leave! I paced the floor to and fro with heavy strides, as if excited to fury by the
observations of the men, but the noise steadily increased. O God! What COULD I do?"
Nervousness
Hopeful
Curious
Cheerful

Answers

Answer:

Suspense

Explanation:

I think the author sets the tone by making the part seem suspenseful by describing sound effects like "A LOW, DULL, QUICK SOUND - SUCH A SOUND THAT A WATCH MAKES WHEN ENVELOPED IN COTTON" Makes the tone panicky and suspenseful.

Answer:

This whole excerpt gives very "Nervous" vibes.

Explanation:

So A: nervousness

Which of the following is the correct MLA format for citing a printed magazine article?
A.
Beth Howard. Better Homes and Gardens. "How to Save Your Own Life." Feb. 2015: 120-122. Print.
B.
"How to Save Your Own Life." Better Homes and Gardens Feb. 2015: 120-122. Print.
C.
Howard, Beth. "How to Save Your Own Life." Better Homes and Gardens Feb. 2015: 120-122. Print.
D.
Better Homes and Gardens. "How to Save Your Own Life." Feb. 2015: 120-122. Print. Howard, Beth.

Answers

Answer:

The correct answer is

Explanation:

B is the correct answer.

Hope this helps....

Have a nice day!!!!

Answer: C.

Explanation: That is always how my teacher told me to put my MLA format.

Which sentence contains a dangling modifier?

Answers

A Dangling modifier modifies the word but does not specify the word in the sentence. For example, in the above passage, the line, 'after trying the new recipe, the chicken pizza tasted delicious' has a dangling modifier.n:

Answer:

i would explain this answer further but your soooo right

Explanation:

I need help with point of view. Sorry if it’s a little blurry but if you zoom in you can see it

Answers

Answer:

for #1 it's third person omniscient / for #2 it's third person limited

Explanation:

whom is mcgonigal trying to convince?

Answers

Answer:  McGonigal is trying to convince her non-gamer audience and concerned parents, teachers, and politicians that gaming is good and beneficial.

Explanation:

ántonia
Which statement best describes how the author
develops the point of view of the narrator?
1. The narrator's feelings of contentment show
that he is unaware of the dangers around him.
en, where snakes could scarcely approach
nyellow pumpkin. There were some
rows, full of fruit. I turned back the
e berries and ate a few. All about me giant
seen, were doing acrobatic feats among
d down the ploughed ground. There in the
-w very hard, but I could hear it singing its
see the tall grasses wave. The earth was
through my fingers. Queer little red bugs
und me. Their backs were polished
I could. Nothing happened. I did not
g that lay under the sun and felt it, like the
g more. I was entirely happy.
2. The narrator's observations of his
surroundings reflect his feelings of
peacefulness and freedom.
3. The description of the narrator shows that he
is excited and optimistic about his future in a
new place.
Which quotation from the passage supports the
answer you chose?
01. "All about me giant grasshoppers, twice as big
as any i had ever seen, were doing acrobatic
feats among the dried vines."

Answers

Answer:

2

Explanation:

Answer:

the first one is 2 and the 2nd one is 3

facts about puritan narratives?
also if you could site your sources that would be great! this is for an english project it’s due tomorrow send help lol.

Answers

-The Puritans were a group of people who grew discontent in the Church of England and worked towards religious, moral and societal reforms. (Www3.nd.edu)
-They believed the Church of England was too similar to the Roman Catholic Church and should eliminate ceremonies and practices not rooted in the Bible. (History.com)
-The name “Puritans” (they were sometimes called “precisionists”) was a term of contempt assigned to the movement by its enemies.(history.com)

How does figurative language INVOKE emotions? I need three different ways, I am trying to start an essay

Answers

Answer:

Similies, metaphors can cause anger, happy or sadness.

Explanation:

Can someone help me with this please

Answers

Answer:

omg maria?

Explanation:

nvm your probably not the one

Which of the following lines is an example of personification?

The old black witch-woman worked on them all summer, every summer, down on her creaky knees, weeding and cultivating and arranging, while the house crumbled and John Burke rocked.
He stood still as an oak tree.
The great oak seemed to laugh with him.
He felt like a great oak.

Answers

Answer:

The great oak seemed to laugh with him.

Explanation:

Personification is basically when a writer gives human traits/abilities to something that isn't living. Since an oak tree, literally speaking, cannot laugh, this line would be personification since it's describing exactly that.

Answer:

The great oak seemed to laugh with him.

Explanation:

Read the poem. Then, select the correct answer
excerpt adapted from
I Wandered Lonely as a Cloud
by William Wordsworth
I wandered lonely as a cloud
That floats on high o'er vales and hills,
When all at once I saw a crowd,
A host, of golden daffodils;
Beside the lake, beneath the trees,
Fluttering and dancing in the breeze,
Continuous as the stars that shine
And twinkle on the milky way.
They stretched in never-ending line
Along the margin of a bay
Ten thousand sawl at a glance,
Tossing their heads in sprightly dance.
For oft, when on my couch I lie
In vacant or in pensive mood
They upon that inward eye
Which is the bliss of solitude:
And then my heart with pleasure fills,
And dances with the daffodils.
Which word best describes the author's tone?
A
admiring
ОВ.
desperate
OC somber
OD playful

Answers

Answer: A: admiring

Explanation:

Just took a test

● Two patients come to a doctor with a headache. The doctor determines that one patient has a brain tumor and the other patient has a run-of-the mill headache. What would the doctor have to do to treat these two patients equally?

Answers

Answer:

For the doctor to treat these two patients equally they would, one show sympathy, explain what actions would be the best to take, and allow patient to ask questions with no judgment involved.  

Explanation:

How does John Winthrop and Jonathan edwards writing differ in terms of purpose, audience, and the selection of details

Answers

He always requested the people to act their best and follow to the standards of God only by living a true generous Christian being is through terms.

How does John Winthrop and Jonathan Edwards writing differ in terms of purpose, audience, and the selection of details?

John Winthrop was an English Puritan lawyer and considered as the famous figures in establishing the Massachusetts Bay Colony.

An excerpt from John Winthrop’s A History of New England that shown Winthrop’s writing style and the structure of his journal is there joined with her.

John Winthrop who was born between January 12, 1587/88, and died on March 26, 1649, at the age of 61 was an English Puritan lawyer and one of the leading figures in founding the Massachusetts Bay Colony, that is the second major settlement in New England after Plymouth Colony.

Learn more about Jonathan Edwards, refer to the link:

https://brainly.com/question/4281954

#SPJ2

What is the purpose of Pre-test?

Answers

Answer:

Pre-tests are a non-graded assessment tool used to determine pre-existing subject knowledge. Typically pre-tests are administered prior to a course to determine knowledge baseline, but here they are used to test students prior to topical material coverage throughout the course.

Answer:

I thinks its to help you better understand the material

Explanation:

Change the following sentence to direct speech. Mother asked where I had kept her bag.

'Where had you kept my bag?' asked mother.
'Where have you kept my bag ?' asked mother.
'Where did you kept my bag?' asked mother.
'Where is my bag?' mother.

Answers

Answer:

'Where have you kept my bag ?' asked mother.

HELP PLZZZ WITH THESE 2 QUESTIONS ASAP GIVING BRAINLIEST AND POINTS PLZZZ HELP GUYS!!!!!!

Read this short passage and answer the questions below:

Excerpt from Crime and Punishment
By Fyodor Dostoevsky

The heat in the street was terrible: and the airlessness, the bustle and the plaster, scaffolding, bricks, and dust all about him, and that special Petersburg stench, so familiar to all who are unable to get out of town in summer—all worked painfully upon the young man’s already overwrought nerves. The insufferable stench from the pot-houses, which are particularly numerous in that part of the town, and the drunken men whom he met continually, although it was a working day, completed the revolting misery of the picture. An expression of the profoundest disgust gleamed for a moment in the young man’s refined face. He was, by the way, exceptionally handsome, above the average in height, slim, well-built, with beautiful dark eyes and dark brown hair. Soon he sank into deep thought, or more accurately speaking into a complete blankness of mind; he walked along not observing what was about him and not caring to observe it. From time to time, he would mutter something, from the habit of talking to himself, to which he had just confessed. At these moments he would become conscious that his ideas were sometimes in a tangle and that he was very weak; for two days he had scarcely tasted food.

Q1).The description of the setting, in the beginning, highlights a contrast between -
A) the rundown part of town and the man’s polished belongings
B) the dirty streets and the man’s clean attire
C) the revolting streets and the man’s attractive outward appearance
D) the terrible smell and the man’s indifference to his surroundings

Q).Which sentence from the text suggests the man was not interested in the circumstances of the world around him?
A) “Soon he sank into deep thought, or more accurately speaking into a complete blankness of mind; he walked along not observing what was about him and not caring to observe it.”
B) “An expression of the profoundest disgust gleamed for a moment in the young man’s refined face.”
C) “He was, by the way, exceptionally handsome, above the average in height, slim, well-built, with beautiful dark eyes and dark brown hair.”
D) “The heat in the street was terrible: and the airlessness, the bustle and the plaster, scaffolding, bricks, and dust all about him, and that special Petersburg stench, so familiar to all who are unable to get out of town in summer—all worked painfully upon the young man’s already overwrought nerves.”

Answers

Answer:

C.

A.

Explanation

For Q1 it doesn't talk about his belongings or clothes so it should be C

Q2 he's not paying attention in that line, "not observing what was about him and not caring to observe it.”

The following question has two parts. Answer Part A first, and then Part B.
Part A Which sentence best states Nhamo's attitude in “The Setting Sun and the
Rolling World"?
a. He feels the old beliefs and traditions are important.
b. He feels the old beliefs and traditions are beautiful.
c. He feels the old beliefs and traditions are worthless.
d. He feels the old beliefs and traditions are challenging.
Part B Which passage from “The Setting Sun and the Rolling World" most clearly
supports the answer to Part A?
a. Nhamo crouched in the dust near his father and greeted him.
b. Charms were for you—so was God, though much later. But for us now the
world is godless, no charms will work.
c. Space had no bounds and no ties. Floating laws ruled the darkness and he
would float with the fiery balls.
d. He was the sun, burning itself out every second and shedding tons of
energy which it held in its power, giving it the thrust to drag its brood
wherever it wanted to.

Answers

Answer:

He doesn't like the fact he has to leave but needs 2

Explanation:

Other Questions
Propaganda is ________________ Two asteroides crashed. The crash caused both asteroids to change speed.Scientist wants to use the change in speed and motion to figure out which asteroide has more mass.Based on the information in the diagram which statement is correct ? In your answer explain ,explain what the forces were like and why the asteroids changed in motion The ability of the_____to perform physical tasks over a period of____without becoming fatigued A primary care physician is a doctor who treats many types of illness and injuries. A specialist is a medical professional who has chosen to focus on one field of medicine, such as an oncologist, who treats only cancer, or a podiatrist, who focuses only on treating foot conditions. What are the advantages of seeing a specialist as opposed to a primary care physician? List at least one circumstance in which you might want to see a specialist, and at least one circumstance in which you might want to see a primary care physician. About 238,000 results (1.16 seconds) "as" (and any subsequent words) was ignored because we limit queries to 32 words. What is the difference between 9 and -2?711-7-11 Write the ratio in simplest form.12:18please help meeee ! !!HELP!! A coral reef, like the one shown in the photo, is a structure composed of the calcium carbonate exoskeletons of corals, a type of animal. Which term best characterizes the role of corals in a coral reef ecosystem? On the periodic table, why are all noble gases placed in column 18 (8A)?A.Noble gas elements have identical molar masses.B.Noble gases are all rarer than elements in other columns.C.The noble gases only chemically react with other noble gases.D.The valence electron configuration is similar in all noble gas elements. The model represents an equation.What value of x makes the equation true? HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop )