Answer:
earthquakes around the North American continent
Pls, I need help with this! Biology Thank you :)
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.I will give you any mark you want.
Answer:
The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.
how do you understand geological hazards?
Answer:
Geologic Hazards
Seismic hazards related to earthquakes, including ground rupture/faulting, liquefaction, strong motion, and tsunami.Landslides of all kinds, including seismically-triggered landslides, debris flows, mud flows, and rock falls.Mineral hazards such as asbestos, radon, and mercury.Explanation:
hope it helps you
please mark me as brainlist
Try to move the different parts of the body
by moving it back and forth, side to side,
rotating, and swinging.
The given question is incomplete, however, the missing part is as follows:
body parts movement
neck _____
lower arm _______
upper arm ________
wrist __________
shoulder _________
skull _________
knee _________
hipbone _________
elbow _________
ankle _________
Answer:
The correct answer is given as follows:
Explanation:
A. side to side
B. swinging
C. rotating
D. rotating
E. rotating
F. back and forth
G. swinging
H. side to side
I. back and forth
J. rotating
could someone help me with this please
Answer:
3
Explanation:
What are the two resulting cells formed from single cell called
how are yarns made up of?
Answer:
Yarn is a strand composed of fibres, filaments (individual fibres of extreme length),... Yarns are made from both natural and synthetic fibre, in filament or staple form. Filament is fibre of great length, including the natural fibre silk and the synthetic fibres.
Answer:
cotton you can get cotton from sheep
PLEASE HELP QUICKLY
Match each of the following to the correct organ system.
Lungs
Heart
Veins
Arteries
Stomach
Large intestine
Trachea
Small intestine
Muscles
Bones
Liver
Pancreas
Gall bladder
Kidney
Bladder
Choices are...
A. Skeletal System
B. Excretory System
C. Digestive System
D. Circulatory System
E. Muscular System
F. Respiratory System
Explanation:
1. stomach - Digestive
2. Brain - Nervous
3. Heart - Cardiovascular
4. kidneys - excretory
5. bone marrow - lymph
6. pituitary gland - endocrine
7. xylem- vascular tissue
8. bones - skeletal
9. Fallopian tubes - reproductive
hope this helps liine some up together i dont give whole answers just try to help ppl out, ill see what i can do thogh, dont quite undderstand can thee be more than one to go with the numbered ones?
PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)
Communicating verbally and nonverbally
Attempting to convince peers to alter their beliefs
Excluding or ignoring
Dressing a certain way or participating in a certain activity
Answer:
excluding or ignoring= rejection
Dressing a certain way or participating in a certain activity= unspoken pressure
Attempting to convince peers to alter their beliefs= pressure
Communicating verbally and nonverbally= insults (?)
If a gene has two alleles, there are two possible genotypes.
a. True
b. False
Answer:
b. False
Explanation:
Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.
Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.
According to Mendel's Law of Dominance, if a gene has two alleles, there are three (3) possible genotypes.
The three (3) possible genotypes are;
I. A combination of alleles such as AA.
II. A dominant combination (phenotype) such as Aa.
III. A recessive combination such as aa.
Where;
A represents the dominant allelea represents the recessive allele.Also, a single version of a gene expressed by a living organism is referred to as an allele.
What is the definition for polyploidy?
The coronavirus attaches to a membrane protein called
Answer:
M glycoprotein..
The coronavirus attaches to a membrane protein called M glycoprotein..
What can we say about the
kinetic energy of the particles
in this object?
A. It has very low energy
B. It has medium energy
.
C. It has very high energy
What is the purpose of cellular respiration. In a short sentence
Answer:
Produce energy (in the form of ATP) for metabolic processes and muscle contraction.
Explanation:
What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell
Answer:
This question lacks options, the complete question is: What do you think would have the greatest effect on the body—a harmful mutation in a pluripotent embryonic stem cell, or a harmful mutation in an adult multipotent stem cell?The correct answer is a harmful mutation in a pluripotent embryonic stem cell.
Explanation:
Pluripotent Stem Cells can self-renew and differentiate into any of the three germ layers, which are: the ectoderm, the endoderm and the mesoderm. These three germ layers subsequently differentiate to form all the tissues and organs within a human being. If during embryonic development, genetic mutations - alterations in genes - occur in the embryonic stem cell, they pass to daughter cells as a consequence of cell division, and an individual is generated whose cells differ at the genetic level. Multipotent stem cells are organospecific cells, that is, they can give rise to any type of cells but from a specific organ (a lung, a kidney or the brain). Their differentiation ends the moment they specialize and become a cell with a specific function within a specific tissue or organ. If there were a mutation in these cells, it would damage a specific designed tissue or organ.
The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation
Answer:
I am pretty sure that the answer is C.
Hopes this helps.
Have a great day!!!!!!!
Match each term to the appropriate description.
Answer:
Have a great day!
Explanation:
The appropriate term for each description would be ecosystem, community, population, organism, and species respectively.
Definition of ecological terms?An ecosystem is a community of all living organisms interacting with their environment as a system.
A community is a collection of different populations of organisms.
A population is a group of organisms of the same species capable of mating.
Species are a group of organisms that is capable of breeding to produce fertile offspring.
Thus, the term for each description would be ecosystem, community, population, organism, and species respectively.
More on ecological terms can be found here: https://brainly.com/question/13046612
#SPJ2
A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).
Answer:
The allelic frequency for pointed ears is 0.5 (50%).
Explanation:
The frequency of alleles in a population must add up to 1 (100%).
The allelic frequency for pointed ears is 0.5 (50%).
What is allelic frequency ?The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.
What is the difference between gene frequency and allele frequency?Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.
To learn more about allelic frequency , here
https://brainly.com/question/23362399?referrer=searchResults
#SPJ2
Which of the following are prokaryotic cells?
A) plants
B) fungi
C) bacteria
D) animals
E) B and C only
fungi, bacteria
If I remember right, eukaryotic means there's more than one, so I believe this answer is right
examples of green house gases
Answer:
Carbon dioxide
Methane
Nitrous Oxide
Explanation:
seasons work help needed please
Answer:
July
Explanation:
it is typically the warmest month of the year globally because the Northern hemisphere has more land masses than the southern hemisphere
I neeed helppppppp
Chemical Weathering 5 facts about it
Answer:
5 Facts
Explanation:
1. When it comes to chemical weathering, it’s all about chemistry. By looking at the term “chemical weathering,” you can see that a chemical reaction causes something to break down or “weather.” That “something” is rocks and minerals.
2. In chemical weathering, rocks and minerals are reacting to acids, oxygen, carbon and water. That’s why no two rocks ever look exactly the same. It’s also the reason that we have those awesome looking caves and unique rock formations all over the world.
3. While chemical weathering creates nifty formations, the way it breaks down rocks also causes fractures in ancient structures like the Great Sphinx of Egypt. It also causes the surface to break down on gravestones.
4. Chemical weathering types can work separately, but they often work together to create landforms and break down minerals.
5. Acid rain caused by pollution such as factory and car exhaust is another agent of chemical weathering.
Each of the following is a density-dependent limiting factor EXCEPT:
- crowding
- predation
- competition
- disease
Answer:
predation
Explanation:
predation
I hop this answer is correct
Answer:
Disease
Explanation:
Hey My Name is Chloe, and I need some Help, But if you can't it's ok,
So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine
Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.
Explanation:
Answer: Animal: Bengal tigers
Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world? Are bengal tigers being bred in captivity.
Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.
Explanation: I would suggest looking at national geographic if you want cooler animals.
At the zoo, Anya observes that individuals of a certain kangaroo species have slightly different sizes and colors. What characteristic of populations is Anya observing?
O adaptation
O evolution
O selection
O variation
Question 1/7 The Nile River carries sediments to the ocean. Over time, the sediments are compressed as more sediments are deposited on top of them. Which type of rock will be formed?
Answer:
Sedimentary Rock
Explanation:
Sedimentary rocks are formed from pieces of sediments or other existing organic matter or rock.
The sedimentary rock formation process begins with weathering which involves the breakdown of the sediments into small fragments. The next process is erosion, where water like the Nile River carries them to other places - in this case, the Ocean.
Over time, the sediments settle and become compressed as more sediments are deposited on top of them.
This leads to the formation of Sedimentary Rocks.
How do antibiotics work? Note: you will not be given credit for simply stating “they prevent bacterial growth” or “they kill bacteria”
Answer:
here's your answer
Explanation:
May this helps you..
Describe the type of plate movement that is occurring where subduction zone volcanoes are found.
Answer:
Convergent boundary
Explanation:
It's when the plates move together and subduction occurs when one plate moves underneath another on a convergent boundary. Volcanoes are found there.
P.S. Brainliest, please?
please help ::( i wanna pass w good grades
Answer:
It's catabolism I think
Explanation:
Answer:
Catabolism
Explanation:
Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.
What do coal deposits tell you about the continents?
Answer:
Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.
