Answer:
circulatory system
Explanation:
Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .
Answer:
Methemoglobinemia.
Explanation:
Some cells release active signaling proteins when membrane-bound precursor proteins are cleaved by proteolytic enzymes. The signaling proteins can then bind to receptors on the surface of a target cell, thereby activating an intracellular signaling pathway and eliciting a response from the target cell. This mechanism of activating receptor-binding signaling proteins has been observed in a variety of organisms from bacteria to humans. Many of the enzymes responsible for proteolysis of membrane-bound precursor proteins have been isolated and characterized.
Required:
What questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species?
Answer:
Following questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species:
Are the genes encoding the proteolytic enzymes expressed in the same cell types in all species? Once the precursor proteins of different species are cleaved, do the active signaling proteins bind to the same receptors on different target cells? If a proteolytic enzyme from one species is incubated with a precursor protein from another species, does correct cleavage occur? Are the proteolytic enzymes synthesized in the rough endoplasmic reticulum of all species?
I NEED HELP, can someone make do this real quick?
Answer:
The answer is A because abc
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein
Answer:
Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.
Explanation:
This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.
The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:
DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC
RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG
Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.
The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).
The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain
Answer:
B. Runoff
Explanation:
Body fat in humans includes both essential and storage body fat.
a. True
b. False
Answer:
true
Explanation:
Answer:
yes that claim is actually true. those are the main fats (correct me if im wrong there)
Which wire, when current flows through it, would be surrounded by the strongest magnetic field?
A thin copper colored bar.
A copper colored coil with 2 turns.
A copper colored coil with 5 turns.
A thick copper colored bar.
Mark this and return Save and Exit
Answer:
A copper with 5 turns
Explanation:
Answer:the other guy is right
Explanation:
write any two uses of Rocks and Minerals of each?
Answer:
The use of rocks and minerals includes building material, cosmetics, cars, roads, and appliances.
Explanation:
can someone please help me with this!
Answer:
large teeth is dominant on small
Answer:
50%
Explanation:
It's a chart based thing but I don't have one, but it's for sure 50%
14. Which nitrogenous base isn't found in DNA?
Answer:
Uracil is a nitrogenous base found in all RNA but not present in DNA.
Explanation:
plz mark brainliest
Answer:
UracilExplanation:
Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.
So, the final answer is Uracil.
1. Imagine you played the game, and the results are as follows. Examine the tables below and questions (a) and (b)
Sample Data for Stable Food Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 2 2
3 4 4 4
4 5 5 6
Sample Data for Stable Food Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 3 2 2
4 4 2 2
A) Describe what happens to the bird population for both the East and West sides of the Islands in terms of its composition of different size beaks when the food source is stable over several seasons.
B) Are the initial populations maintained, explain?
2. Imagine you played the game again, but under different conditions. Examine the tables below, and answers (a), (b), and (c).
Sample Data for Natural Selection Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 3 3
3 4 3 2
4 8 5 0
Sample Data for Natural Selection Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 2 2 2
4 2 0 3
A) What happened to the composition of the original population over these four seasons for the East and the West?
B) What factor(s) might have caused these changes?
C) How was natural selection acting on this population?
Answer:
The population is increase in the east due to good and wet environment.
Explanation:
The bird population of the East and west sides of the Islands is increases of different size beaks when the food source is stable over several seasons because the presence of food to all size of beaks leads to increase in their populations. The initial populations is increased in the east side as compared to west side may due to good environmental conditions. The population of east side increases as compared to west side due to good and favourable environmental condition of the east side of the island.
Process 2 is known as
Answer:
Transcription
Explanation:
From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.
Hence, in this case, the correct answer is TRANSCRIPTION
2. Which is an example of interspecific competition?
blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden
Base your answers to the following question on the structures represented in the diagram.
Review Packet- Modern Genetics Name___________________________ Page 1
What is the relationship between these three structures?
Group of answer choices
Protein is composed of DNA that is stored in the cell
The cell is composed only of DNA and protein
DNA is made up of proteins that are synthesized in the cell
DNA controls the production of protein in the cell
When can an acquired mutation be passed from parent to offspring
One of the biggest sources of greenhouse gases released into the
atmosphere is emissions from burning fossil fuels. How could carbon
sequestration help alleviate problems associated with burning fossil fuels?
A. It could make fossil fuels a clean-burning energy resource.
B. It could prevent carbon dioxide from being a greenhouse gas.
O C. It could prevent released carbon dioxide from entering the
atmosphere.
D. It could make fossil fuels a renewable energy resource.
Answer:
The correct answer is - B. It could prevent carbon dioxide from being a greenhouse gas.
Explanation:
Carbon sequestration is the process that involves capturing and removal of atmospheric carbon dioxide from the atmosphere and prevent it from changing climate by increasing global warming as carbon dioxide gas traps the heat.
It is helping in the removal of excess carbon dioxide from the atmosphere and prevents it from being a greenhouse gas and increase global warming. It could be geological or biological.
Answer: C- it could prevent released carbon dioxide from entering the atmosphere
Explanation: ap3x
what is deposition ?
Answer:
it is a geological process where sediments, soil, and rocks are added to a landform or mass
Answer:
Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court
Explanation:
hope this helps
Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A
Answer:
William will be more attracted to Kate than he would a stranger.
Explanation:
Option B is your answer choice. Have a great day ☺
On the effects of similarity on attraction, the following is most likely to be William's reaction, William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.
How they both share many of the same beliefs and interests?Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.
Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.
Thus, option "B" is correct.
To learn more about psychology click here:
https://brainly.com/question/10980588
#SPJ2
f(x) = −16x2 + 60x + 16
Answer:
x = − 0.25 , 4
x = − 1 /4 , 4
Explanation:
The spinal cord is automatically arranged with
cervical region
spinal nerves
central canal
1. Geologists use physical properties to identify minerals. For example, the blank
cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture
Answer:
The correct answer is - crystal form (external shape).
Explanation:
Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.
The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.
Answer:
crystal form external shape
Explanation:
i copied lol
Create some GREAT SCIENTIFIC game of hide and seek to play in class.
Answer:
you can place scientific terms around the classroom and the kids must work in groups to find the cards. Then you let the kids read the terms at the end.
Explanation:
Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult
what two gases easily diffuse through the phospholipid bilayer
Answer:
Consider substances that can easily diffuse through the lipid bilayer of the cell membrane, such as the gases oxygen (O2) and CO2. O2 generally diffuses into cells because it is more concentrated outside of them, and CO2 typically diffuses out of cells because it is more concentrated inside of them.
Choose all the answers that apply.
Which of the following energy sources harms the
environment?
A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil
Answer:
c nuclear power because it destroy the places
DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes
Answer:
The answer is chromatin and chromosomes.
Which of the following statements about lichens are true?
Answer:
The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.
Answer:juegan maincra
Explanation:porque si
Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome
Answer:
B. Histone because they are a family of small positively charged proteins.
Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.
a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences
1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods
Answer:
1. Map-based genome sequencing: a; c; f; g
2. Whole-genome shotgun sequencing: b
3. Both sequencing methods: d; e
Explanation:
Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.
