Someone’s help me please

Someones Help Me Please

Answers

Answer 1

Answer:

trailmix

Explanation:


Related Questions

The products in our society that contribute the most waste are those that are _____.

Answers

Answer:

disposable

Explanation:

Biodegradable products do not really present any problems because they can decompose on their own, thus they do not create any pollution. Aluminum is not as dangerous to the environment as plastics, for example.

A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll

Answers

Answer:

GL Gl gL gl

Explanation:

why do some scientists believe that humans evolved from apes?

a: because fossil records show homologous structures indicating a common ancestor

b: because humans and apes lived around the same time period

Answers

Answer:

A

Explanation:

Because it is way more logic

Outline the process of the Carbon Cycle.

Answers

Answer:

Carbon Cycle Definition

Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.

Carbon Cycle Steps

Following are the major steps involved in the process of the carbon cycle:

Carbon present in the atmosphere is absorbed by plants for photosynthesis.

These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.

These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.

Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.

These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.

Hope it helps!!!

Acid rain is caused by: *
*
O
a. Mass amount of CO2 in the atmosphere
O b. Reduction of pollutants
O c. Organisms that release acid into the atmosphere
O d. Planting more trees

Answers

Answer:

Mass amount of CO2 in the atmosphere

What is the difference between a missense mutation and a silent mutation?

Danke schon! Ilysm <3

Answers

Answer:

Answer is in explanation

Explanation:

A silent mutation is a mutation in which a single nucleotide base is changed, but that change does not effect the amino acid sequence. A missense mutation is a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid.

The mutation is caused by the exchange of one base pair if no change in the overall protein (silence mutation),  if there is change in one amino acid (missense mutation).

What is a silent mutation?

A mutation is a difference in the DNA sequence of an organism.

Silent mutations happen when the difference of a single DNA nucleotide within a protein-coding portion of a gene does not influence the sequence of amino acids and the protein.

Thus, silent mutation has no change whereas stop mutation leads to termination of protein.

To learn more about mutation click here:

https://brainly.com/question/13923224

Help me PLEASEE!!! IT will mean alot

Answers

It’s probably B (I’m guessing)

Answer:

I believe the answer is C.

Explanation:

Formula is Glucose + 6 Oxygen makes energy, 6 carbon dioxide molecules and 6 water molecules.

Organisms such as yeast can reproduce through mitotic division. During this type of reproduction, nondisjunction is possible.
True
False

Answers

I believe that it is true
i think it is true because true

What makes an isotope radioactive? Are all isotopes radioactive?

Answers

Answer:

Radioactive Elements

In elements with more than 83 protons, all of the isotopes are radioactive. ... The force of repulsion among all those protons makes the nuclei unstable. Elements with more than 92 protons have such unstable nuclei that they don't even exist in nature.

Explanation:

hope it helps you

follow me for more

I'm willing to help

i need help with biology if you’re willing to help pls lmk :)

Answers

Answer:

sddssa

Explanation:sa

explain how the genus and species name of an organism is properly written

Answers

Answer: The binomial system of nomenclature is structured so that the scientific name of a plant consists of two names: (1) the genus or generic name, and (2) the specific epithet or species name. ... The genus name is always underlined or italicized. The first letter of the genus name is always capitalized.

Explanation:

Plz I will give brainliest

Answers

The correct answer is C

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories

Answers

Answer:

D. 367

Explanation:

If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.

What is food energy?

Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.

The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.

To find the total calories, multiply the given biomolecules grams with their calorie count.

= 42 × 4 + 7 × 9 + 34 × 4

= 168 + 63 + 136

= 367 calories

Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.

Learn more about energy, here:

https://brainly.com/question/839331

#SPJ5

What are the five main phases of the cell cycle? What are the main events in each?

Answers

Answer:

In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.

Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.

Explanation:

good luck

please mark me as a brainliest

15 points answer please

Answers

Answer:

B

Explanation:

Answer: B
The particles will stop completely

Why does Mr. Brunner care for Percy so much?

Answers

because he is watching over percy, and mr.brunner is actually chiron, a cenataur, and was taking percy to camp half blood

GIVING BRAINLIEST AND EXTRA POINTS!!


The octopus can change its coloring to blend into its environment, and the sweet pinesap plant appears to look like dead leaves on the ground. How do these adaptations help the plant and animal survive?

A) They protect them from predators.
B) They protect them from the environment.
C) They allow them to stand out.
D) They allow them to reproduce.

Answers

I think the answer is A, they protect them from predators
it’s a it protects them from predators

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

Tropical rainforests have the greatest biodiversity of any type of land ecosystem how does biodiversity contribute to the sustainability of an ecosystem

Answers

Biodiversity contributes to the sustainability of an ecosystem in ways such as biodiversity, ecosystem stability, ecosystem resilience, nutrient cycling, pollination, and medicinal properties.

Biodiversity is crucial for the sustainability of an ecosystem as it plays a significant role in maintaining the functioning of ecosystems and providing a range of ecological services. In tropical rainforests, which have the highest biodiversity, the presence of numerous species of plants, animals, fungi, and microorganisms contributes to the sustainability of the ecosystem in the following ways:

Ecosystem Stability: Biodiversity helps to maintain the stability of an ecosystem by providing a balance between predator and prey populations, nutrient cycling, and decomposition.

Ecosystem Resilience: The greater the biodiversity of an ecosystem, the more resilient it is to disturbances such as climate change, natural disasters, and human activities.

Nutrient Cycling: Biodiversity helps in the efficient cycling of nutrients in the ecosystem. Different species of plants and microorganisms play a role in decomposing organic matter, recycling nutrients, and maintaining soil fertility.

In summary, biodiversity is essential for the sustainability of ecosystems. It provides ecological services that are critical for maintaining the functioning of the ecosystem and contributing to human well-being.

To learn more about Biodiversity here

https://brainly.com/question/29765125

#SPJ1

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

Which two words best describe the Sun? Select one:
A)planet and gases
B)star and rocky
C) star and gases
D)planet and rocky

Answers

Answer:

I'm pretty sure it would be c

Explanation:

because it is a star so it definitely is not a or d and I don't think it is rocky soooo

Lysogenic viruses do not

Answers

Answer:

Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.

Explanation:

You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.

Answers

Answer:

C is the best answer

Explanation:

the dominate trait is in 3 of the four boxes

There is a 75% chance that each offspring will be tall. Therefore option C is correct.

When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.

The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.

The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.

Therefore option C  There is a 75% chance that each offspring will be tall is correct.

Know more about genotype:

https://brainly.com/question/31515990

#SPJ5

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

The 1st organism in a food chain must always be what type of organism?

Answers

Answer:

Producer

Explanation:

I think it should be producer.

Answer:

Producer

Explanation:

The 1st organism in a food chain must always be what type of organism?

Producer

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!

What do agriculture and urbanization have in common?

Answers

Answer:

Agriculture and urbanization both have the goal of expanding human value of living.

Explanation:

Answer:

Explanation:

Basically both of them benefit each other .

Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands.  It can also bring major challenges for urban and rural food security.

Hope this helped !

3
ANNOTATE Write the inputs and outputs of cellular respiration on this diagram.

Answers

Answer:

Inputs---- glucose and oxygen.

Outputs----- ATP, carbondioxide and water.

Explanation:

The inputs of cellular respiration are the glucose and oxygen whereas the outputs of cellular respiration are energy in the form of ATP, carbondioxide gas and water. cellular respiration is a process in which glucose is broken down in the presence of oxygen gas for the production of energy in the form of ATP molecules. Carbondioxide gas and water which are the waste materials also produced in the end of cellular respiration process. Cellular respiration is the reverse of photosynthesis.

Other Questions
Do you think there is a "right way" and a "wrong way" to live? Which best describes the relationship between the terms frequency, wavelength, and hertz? In this portion of the U.S. Constitution, which branch ofthe government checks the power of which other branchof government by a two-thirds agreement? For an experiment, a scientist designs a can, 20 cm in height, that can hold water. A tube is installed at the bottom of the can allowing water to drain out. At the beginning of the experiment, the can is full. When the experiment starts, the water begins to drain, and the height of the water in the can decreases by a factor of 1/3 each minute.Complete the graph. When throughout history have we seen types of government or economic systems cause conflict between two countries? What is the image point of (-9,-2) after the transformation T-2,-5 lthe farmer hgjhbjurd What is the volume of a hemisphere with aradius of 26.7 m, rounded to the nearest tenth ofa cubic meter? Find the volume of the irregularfigure.1 cm2 cm? ]cm38 cm1 cm3 cm3 cm5 cmWhat is the answer to the question tell me if you cant see the photo! photo is above the picture! Which types of narrators do you think authors would use when writing about the Cuban Revolution? Select all of the narrator types that you believe would be appropriate. Cuban exiles who emigrated to the United States after the Cuban Revolution Cuban exiles who fought against Fidel Castro Cubans who stayed in their country after the Cuban Revolution Cuban citizens who are loyal to Fidel Castro Cubans citizens who do not always support Fidel Castro Americans who are neighbors of Cuban exiles Children of Cuban exiles who have grown up in the United States What happened in the 1960's in Quebec?United States raided the borders of Canada.Radicals demanded more recognition of their heritage.Voters rejected a separation referendum.The Quebec Act was passed by the British.Random answers and links will be reported! 42 - 35 = 8 - 12 + t What does t mean? x ^ 2 + y ^ 2 = 34. x + y = 2 . please help me out Actividad 3Resuelve el crucigrama a partir de las pistas que se te presentan.SANNEVerticalvegetal color naranja que los conejoscomenon dibujos2 se usa para hacer vinofruta pequena color rojo y dulce5 vegetal redondo grande til en ensaladasvegetal que se usa en combos de comidarapidavegetal picante muy popular en Mexicorica en vitamina C10 fruta grande y roja con muchas semillasCananasaHorizontal4 fruta amarilla muy popular6 fruta tropical grande y pesada7. vegetal blanco y pequeo muy comun11vegetal grande que se come verde o maduro12 roja por fuera y blanca por dentro13vegetal de capas redondo y pecuero usadoen ensaladasfruta de paises tropicales con cascara dura15 vegetal rojo y pequeno uti en variosplatitos You roll a six-sided number cube and flip a coin. What is the probability of rolling a number less than 2 and flipping heads? *1/121/46/22/6 A net has a square at the center and 4 triangles on the sides. The square has side lengths of 2 feet. The triangles have a base of 2 feet and a height of 5 feet.Rahul is wrapping a gift that has the dimensions shown. What is the least amount of wrapping paper he will need? ft2 Can someone help me please They are set of letter that are added to the and of an existing word to create a new one. 1. Prefix 2. Making predictions 3. Suffix Help! A 45.7 kg woman starts from rest at the bottom of a flight of stairs that hasa total height of 2.54 meters. She reaches the top of the stairsin 5.00 seconds. How much power does she generate if she is moving at2.63 m/s at the top of the stairs? Use g = 9.8 m/s2, and only include 3numbers in your answer.