Please Help I will Mark Branliest for first answer Please

Please Help I Will Mark Branliest For First Answer Please

Answers

Answer 1

Answer:

to break down waste and worn-out cell parts

Explanation:


Related Questions

Cytotoxic T cells protect the body by _____________.

A. secreting toxic substances that destroy pathogens

B. phagocytizing invaders

C. activating the complement system

D. making antibodies that float free in the body fluids

Answers

C.) Hope it helps :)

the process which takes place in guard cells but not in other epidermal cells is?​

Answers

Answer:

guard cells chloroplasts , involved in the photosynthesis where epidermal cells are living cells covering the outside surface of the herbaceous plants they contain a thick covering of cutting which reduces the water loss from Plants epidermal cells in roots are specialized for water and ion absorption don't know if it helped but good luck

Photosynthesis

The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. The upper and lower epidermal cells do not have chloroplasts, thus photosynthesis does not occur there.

Difference in guard and epidermal Cells:

Two guard cells form a stoma, controlling the gas exchange of the plant by regulating the size of the stoma whereas epidermal cells provide a protection to the plant from the external environment.

Photosynthesis does not take place in epidermal cell because:

The epidermal cells that make up this skin are transparent. As most epidermal cells lack chloroplasts, they can't perform photosynthesis, or the use of sunlight to convert carbon dioxide and water into glucose and oxygen.

Learn more:

brainly.com/question/9498584

During meiosis, homologous chromosomes can exchange DNA in a process as shown in the diagram
below known as

Answers

The answer is: crossing over

Need help on part 2 pls leave some answer

Answers

Answer:

The correct answer would be -

Punnett square is given below and on the base of the result of Punnett square, Millie should mate with Denver to get three different colors of puppies.

Explanation:

The question says that Millie has a genotype BB*, which is a combination or heterozygous condition of dark brown allele B and white allele B*, now cross with Denver (light brown color):

Cross 1:

         B      B*

 B    BB   BB*

  B*  BB* B*B*

the results is : 25% dark brown, 50% light brown and 25% white.

cross 2: with Charley (white color)

    B     B*

B* BB*  B*B*

B* BB*  B*B*

there is only white and light brown puppies produced

Thus, the correct answer is - Denver.

Bro help me please someone

Answers

Answer:

B

Explanation:

Answer:

B

Explanation:

coz it more direct in terms of thesis

There plz help me :(((

Answers

Answer:

Your answer would be Horse chestnut

Answer:

hello how are you

Explanation:

I'm fine

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

Which group of organelles is directly responsible for the production of new molecules within a cell?

answers:

Ribosomes, endoplasmic reticulum, Golgi apparatuses


Golgi apparatuses, lysosomes, and plasma membrane


Endoplasmic reticulum, plastids, and vacuoles


Nucleolus, vacuoles, ribosomes

Answers

Ribosomes, endoplasmic reticulum, Golgi apparatuses

7. Fill in the blanks using the words: glucose | monosaccharide | energy | carbon | lipids | C6H12O6 | polysaccharide | carbohydrates All matter, must contain ________________________ to be considered organic. ______________________________, composed of starches and sugars are generally used in cells as a source of ___________________________. If a carbohydrate has more than one sugar, it is considered a _________________________________. The single subunit of a polysaccharide is a __________________________________. An example of a monosaccharide is __________________________ and its formula is ___________________________.

Answers

Answer:

Carbon, carbohydrates, energy, Polysaccharide, glucose, C6H12O6.

Explanation:

All organic matter must contain carbon in its composition then it can be considered as organic compound. Carbohydrate is composed of starches and sugars are generally used in cells as a source of energy. If a carbohydrate has more than one sugar, it is considered as a Polysaccharide. The single subunit of a polysaccharide is a glucose. An example of a monosaccharide is glucose and its formula is C6H12O6 . If a carbohydrate has one sugar, it is considered as a Monosaccharide whereas If a carbohydrate has two sugar, it is considered as a Disaccharide

The correct words for the given blanks are:

1. All matter, must contain carbon to be considered organic. Organic compounds are those compounds that have carbon and hydrogen bonds.

2. Carbohydrate is composed of starches and sugars are generally used as a source of energy. Starch is a stored form of energy in plants, whereas humans have glycogen as the stored form of energy.

3. If a carbohydrate has more than one sugar, it is considered a polysaccharide. Polysaccharides are starch, glycogen, and maltose.

4. The single subunit of the polysaccharide is a monosaccharide. It is the basic form of polysaccharides, which are combined by glycosidic bonds to form oligo or polysaccharides.

5. An example of a monosaccharide is glucose. Glucose is the primary substance required for the production of energy. Its formula is [tex]\rm C_6H_{12}O_6[/tex].

To know more about carbohydrates, refer to the following link:

https://brainly.com/question/16987478

Question 21 (1 point) Sustainable use is often defined as the use of natural resources at a rate that meets the needs of the present human population but which also allows future generations to use the resource to meet their needs. Which of these BEST illustrates the concept of sustainable use? A fishing trawler uses a large net to catch a school of small fish A logging company reseeds and replants in a forested area after cutting down trees for timber Crops are rotated in a farmer's field to maximize grain yields Coal is mined using underground tunnels to avoid the destruction of surface soils by strip mining

Answers

Answer:

A logging company reseeds and replants in a forested area after cutting down trees for timber

Explanation:

Answer:

Sustainability is the capacity to endure in a relatively ongoing way across various domains of life.[1] In the 21st century, it refers generally to the capacity for Earth's biosphere and human civilization to co-exist. It is also defined as the process of people maintaining change in a homeostasis-balanced environment, in which the exploitation of resources, the direction of investments, the orientation of technological development, and institutional change are all in harmony and enhance both current and future potential to meet human needs and aspirations.[2][failed verification] For many in the field, sustainability is defined through the following interconnected domains or pillars: environmental, economic and social,[3] which according to Fritjof Capra,[4] is based on the principles of systems thinking. Sub-domains of sustainable development have been considered also: cultural, technological and political.[5][6] According to Our Common Future, sustainable development is defined as development that "meets the needs of the present without compromising the ability of future generations to meet their own needs."[7][8] Sustainable development may be the organizing principle of sustainability, yet others may view the two terms as paradoxical (seeing development as inherently unsustainable).[9]

Explanation:

Complete burning of fossil fuels releases carbon primarily to what part of the biosphere?


NO LINKS OR I WILL REPORT YOU!

Answers

Answer:

Atmosphere

Explanation:

carbon dioxide is naturally released into the atmosphere by the decay and flatulance of animals. But you extract fossil fuels from the ground and burn them. The burning of fossil fuels is called combustion.

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

Which type of selection is illustrated by these two graphs?

A.) directional
B.) stabilizing
C.) disruptive
D.) natural

Answers

Answer:

B

Explanation:

What is the difference between mold and cast fossils? A Mold fossils fom from collected minerals and cast fossils do not B. Mold fossils are impressions intock and cast fossils fomm from minerals filling molds cast fossils are impressions Into rock and mold fossils form from minerals filling casts Cast fossils are formed in sedimentary rock but mold fossils are not​

Answers

I believe the answer is B.

when an animal dies and its body decays, it can leave an imprint in the sediment. If this imprint fills in with minerals from sediment and groundwater, it can harden to form a fossil. This fossil is called a cast fossil. The fossilized imprint is called a mold fossil.

Somebody please help? Thanks​

Answers

Answer:

None

Explanation:

because y is recessive and it needs to be yy to be green so Yy wouldn't wrok

The answer is none


...

5. What helps predict the weather now? A. tea leaves B. sky color C. radios D. computers​

Answers

Should be D. Bc of satellites being kinda similar to a computer.

I think it's C.

Hope it helps

An elephant has a long, powerful trunk. According to the ideas of Lamarck, how did the trait of long, powerful trunks develop in elephants?

Answers

Answer:

Gradually, as generations of elephants continued to selectively use and develop their trunks.

Explanation:

Jean-Baptiste Lamarck was  famous French Naturalist. He was a soldier, a biologist and an academic. He gave an early theory of evolution known as the theory of Lamarckism.

It was Lamarck who first believed that elephants earlier had small trunks. But eventual when there was scarcity of food and water, the elephants stretched out its trunk to reached out for food such as trees and also water. And as a result their offspring inherited long and powerful trunk.

In his theory of Lamarckism, he believed that the species passes on its traits to the offspring which they acquired through their use in their lifetime. In this case, the elephants might have used their trunks in such a way that they became long and strong over time and they passed tis trait to their babies.

What is the correct sequence order in the process of making a protein?
a. protein to DNA to mRNA
b. mRNA to DNA to protein
c. DNA to mRNA to protein
d. mRNA to protein to DNA
( 20 pts. need this answer urgently !! )

Answers

Answer:

i think its c, 85% sure :D

Explanation:

10. are a type of producer found in aquatic environments. In a particular lake, the phytoplankton have begun to
reproduce much more rapidly and grow much faster, causing a green "bloom” to cover the whole surface of the
lake. Which of the following is the most likely cause of this bloom"?

Answers

Answer: I think that it would be C because blooms are due to eutrophication, which means that there are high levels of phosphate in the water. Phosphate is a main ingredient in pesticides, which can run-off into rivers.

Explain why flask #2 (yeast with glucose) produced more CO2 than flask #5 (yeast with flour). AND how did you know it produced more CO2?

Answers

Answer: Glucose

Explanation:

The carbon dioxide produced in the experiment can be directly related to the energy generated after the fermentation process. The carbon dioxide is the byproduct of the chemical reactions in the ethanolic fermentation. Glucose substrate will yield the highest energy along with the highest producer of the carbon dioxide after the fermentation process conducted by yeast as compared to the fermentation process that was conducted by yeast with flour. The flour will offer a source of carbohydrates including starch and sugars. The yeast will find out sugar in the flour and ferment it. Glucose is readily available sugar for the action of yeast so more production of carbon dioxide is expected from glucose substrate.

PLEASE ANSWER THIS DUE BY 3:00 PM PLEASE
THIS IS NOT MULTIPLE CHOICE AND I DID NOT MEAN TO SELECT D.

( I put a better view of the graph)

Answers

Answer:

option C suits the best

Explanation:

The answers and why they are correct or incorrect:

A:

Incorrect because it cannot be answered with the graph and does not apply.

B:

Incorrect since the loudest sound ever recorded is not on the graph.

C:

Correct because the graph shows the difference Between normal conversation vs whispering.

D:

Incorrect, because like the first one it cannot be answered with this graph and makes no sense.

I HOPE I HELPED!!! HAVE AN AMAZING DAY/NIGHT!!! PLEASE MARK ME BRAINLIEST IF I HELPED YOU!!

PLEASE HELP ME

Why are planets round?
*
A.Gravity pulls mass in one direction

B.Gravity pushes mass out from the center

C.Gravity pulls mass into its core from all directions equally

D.Elliptical orbits smooth out planetary imperfections

Answers

Answer:

c

Explanation:

planets are round because of their gravitational field acts as though it pulls everything from the center of its body and pulls everything toward it

Do primers create a single stranded section of dna

Answers

Answer:

Yes

Explanation:

A primer is a short, single-stranded DNA sequence used in the polymerase chain reaction (PCR) technique. In the PCR method, a pair of primers is used to hybridize with the sample DNA and define the region of the DNA that will be amplified. Primers are also referred to as oligonucleotides.

need answer quick please thanks

Answers

beta cells in the pancreas

Explanation:

the cells make other cells in order to keep you blood cells moving

Which of these is NOT a reason organisms migrate?
A reproduction
B warmer temperatures
C higher availability of food to find more

Answers

Is there supposed to be another answer choice?

Please help me with this

Answers

Answer:

I think the answer is C. Co-dominance

Explanation:

I need help with this ASAP

Answers

Answer: tissues, organs, organ system

Explanation:

goes from top to bottom

In males, the 4 haploid or diploid cells at the end of Meiosis 2 become 4 sperm cells.

Answers

Is this supposed to be a true or false question I’m kind of confused sorry that I can’t help out

A study is done to compare the fuel efficiency of cars the first group of cars generally gets 35 miles per gallon the second if a car is generally gets about 50 miles per gallon based on the mean values of each group what inference can be made what else might a person to conclude from mean values

Answers

Answer:

The effeinty

Explanation:

Question #1: Which classification level is the most inclusive or least specific?

1. Kingdom
2. Domain
3. Species
4. Genus
———————————————
Question #2: Fungi and Plantae are different from each other because fungi are heterotrophs and plantae are autotrophs.

True or False?
———————————————
Question #3: In binomial nomenclature the first name is the _____ and the second is the _____.

1. genus; species
2. kingdom; domain
3. order; species
———————————————
Question #4: Binomial Nomenclature is a ________________.

1. two term naming system
2. a species found in the Amazon
3. organism cell structure
4. a form of cell
———————————————
I will give brainliest!

Answers

Question 1=3
Question 2= true
Question 3=1
Question 4=1
Other Questions
x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution John wanted to buy his favorite rubber shoes. Its original price is $105. He is lucky today because the shoes that he wanted to buy is 30% off the original price. How much will John pay now for his shoes? Find the value of x. Then find the mB and mC. Why/how did the Black Identity or Black Arts Movement influence visual art? Suppose the Federal Reserve sets the reserve requirement at 14%, banks hold no excess reserves, and no additional currency is held. Instructions: In part a, round your answer to 1 decimal place. In parts b and c, enter your answers as a whole number. If you are entering a negative number include a minus sign. a. What is the money multiplier