please help

Yo _________________ la clase de geografía. (enseñar)

a. está enseñando

b. estoy enseñando

c. estás enseñando

d. es enseniando


no dam links

Answers

Answer 1
The answer is b. Estoy enseñando

Related Questions

Antes de abordar el metro compro el
el tique
b. el plano
C.
la parada
la esquina
d.
Please select the best answer from the choices provided

Answers

Antes de abordar el metro compro el tique

Answer:

The answer is A )El tique The sentence in English will be "Before boarding the train I bought the ticket "

Completa la siguiente tabla, de español

Answers

Necesito la pregunta a

El____(ir) a la bibloteca

Answers

Answer:

answer is va

Explanation:

i think that

what is the full form of mcc and BBC​

Answers

Answer:

ᴍᴄᴄ - ᴍᴏʙɪʟᴇ ᴄᴏɴᴛʀᴏʟ ᴄᴏᴅᴇ /ᴍᴏᴛᴏʀ ᴄᴏɴᴛʀᴏʟ ᴄᴇɴᴛʀᴇ

ʙʙᴄ - ʙʀɪᴛɪsʜ ʙʀᴏᴀᴅᴄᴀsᴛɪɴɢ ᴄᴏʀᴘᴏʀᴀᴛɪᴏɴ

[tex] \infty \infty [/tex]

Answer:

[tex] \underline{ \underline{ \large{ \tt{ ☃ \: F\: U \: L \: L \: \: F \: O\: R \: M \: S}}}}: [/tex]

MCC = Millennium Challenge Corporation

BBC = British Broadcasting Corporation

[tex] \underline{ \underline{ \large{ \tt{☂ M \:E\: A \: N \: I\: N \: G \: S}}} }: [/tex]

British Broadcasting Corporation - A large publicly financed broadcaster of television and radio programmes in the UK , the world via the BBC World service.

MCC - The Millennium Challenge Corporation is an agency established by the US Congress in 2004 applying the philosophy towards foreign aid.

♡ Hope I helped! ツ

☥ Have a wonderful day / night ! ♪

♨ [tex] \underbrace{ \overbrace{ \mathfrak{Carry \: On \: Learning}}}[/tex] ✎

▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁

Future Tense. Select the best choice from the options available in order to fill in the blank with the correct conjugation of the verb in parenthesis of the following sentence. Yo __________________ (mirar) esta película nueva el viernes por la tarde. Group of answer choices mirará miré miró miraré

Answers

Answer: yo voy a ver esta pelicula nueva el viernes por la tarde.

Explanation:

voy a ver is future

mirando is present

Answer:

Yo miraré esta película nueva el viernes por la tarde.

Help meeeeeeee

B) Write the name of the food that does not belong to the same category and explain why.
Ex. tarta- helado-pimienta-manzana. La pimienta. No es dulce.

1. refresco/agua/leche/carne/. _______________________. _________________________
2. banana/manzana/pescado/naranja/.________________. ________________________
3. fruta/helado/torta/pescado/. ________________________. ________________________
4. pollo/ pescado/carne/refresco/. _______________________. ______________________
5. pastel/ leche/ jugo de naranja/té/______________________. _______________________

Answers

Answer:

Explanation carne is meat so its carne

pescado is fish and the others are fruits

they seem to not all fall in the same catergory

and the last odd one is refrescro

1) Refresco/Agua/Leche/Carne. La Carne. No es un líquido

2) Banana/Manzana/Pescado/Naranja. El pescado. No es una fruta

can someone write 5-6 sentences describing the things in nature you love the most, and then why do you like them. brainliest to you plus 100 points.

Answers

Everything that we see and feel around us such as trees, plants, animals, the aroma of flowers, the sweetness of fruit, and any other products that are manufactured by the earth is collectively called Nature. It’s a non-returnable blessing to mankind. Nature can also be mentioned as the phenomenon which takes place around us daily like the flowing of water, the sense of cold air, and the birds chirruping we hear. Healthy and wealthy nature is very important for the well-being of humans. However, it can also show you its worst negative side. If you want the best from nature, just give it the best you can.

I like all of these things because it shows what the real world is like without all the chemicals in the air and all the cities. The sounds of nature are amazing and nice because they are all natural, and not fake or from a speaker.

Lleva el cuaderno y los bolígrafos en ____. a. una mochila c. una papelería b. una camisa d. una regla

Answers

A. Mochila/backpack

Can someone please help meee!!!

Answers

A donde vas?
Por que te vas?
A que hora vas?
Como te vas?
Con quien vas?
Cual?

Courses that enable students to begin jobs that require course completion
certificates are known as:

Answers

technical vocational courses.

Listen to the audio and then answer the following question. Feel free to listen to the audio as many times as necessary before answering the question. Where are you most likely to hear these instructions? el hospital en la escuela en la oficina en el parque

Answers

Answer:

b

Explanation:

its b

The instructions mentioned in the Audio in Spanish, very surely belong to:

B. En la escuela

Audio summary.

In the audio you can hear many instructions given by someone who seems to be a school teacher, things regarding the assignments that a student could receive, tasks that would be left to deliver in the near future and other things regarding the organization of the classroom class.

All these instructions, in general are usually heard in a school, which translates into Spanish "escuela."

More information:

https://brainly.com/question/25075054

please change the verb in the parentheses to the correct preterite form to match the subject .
Anoche tú_______(tocar) el piano.

Answers

Answer:

Anoche tú_tocaron______ el piano.

Explanation:

The correct answer is TOCASTE. “Anoche tú tocaste el piano”

Decide whether to use the imperfect or the preterite form of the verb in the blanks below.
Anoche (estar) ________ cuando mi hermano (caerse) ________. El (llorar) _______ mucho porque (quebrarse) ________ la mano. Mi mamá (gritar)______ y yo (correr)______ por toda la case sin saber que hacer. Mi papá nos (llevar)_______ al hospital para que curaran a mi hermano. En el hospital yo (dormir)______ por horas mientras esperábamos. Toda mi familia (llegar)_______ para visitar a mi hermano. Mis abuelos (ir) _________ a la cafetería y (comprar)______ muchos dulces para nosotros. Al final yo también (enfermarse) ______ del estómago.

Answers

Answer:

wrote down below

Explanation:

Anoche (estar) __estaba______ cuando mi hermano (caerse) ___Callo_____. El (llorar) __lloro_____ mucho porque (quebrarse) ____QUEBRO____ la mano. Mi mamá (gritar)__GRITO____ y yo (correr)__CORRI____ por toda la case sin saber que hacer. Mi papá nos (llevar)__LLEVO_____ al hospital para que curaran a mi hermano. En el hospital yo (dormir)__DORMI____ por horas mientras esperábamos. Toda mi familia (llegar)_LLEGO______ para visitar a mi hermano. Mis abuelos (ir) __FUERON_______ a la cafetería y (comprar)_COMPRARON_____ muchos dulces para nosotros. Al final yo también (enfermarse) __ENFERME____ del estómago.

I don’t understandddd , helppppp.

Answers

Answer:

está

5 Estás

   estoy

6 está

   está

7  Están

    están

Explanation:

PLEASE HELP ASAP


Lee el fragmento y contesta la pregunta. Read the excerpt and respond to the question.

En Cenizas de Izalco, la búsqueda de la identidad y la autoridad son temas centrales inscritos en las diversas voces narrativas; tanto Frank como Carmen desean establecerse como voces autorales con el fin de relatar sus experiencias. Menos obvia, sin embargo, es la intención de Alegría de establecer las identidades narrativas de las voces oprimidas, tales como la mujer y, sobre todo, la voz de los campesinos que quedan excluidos del canon textual. El narrador masculino de Cenizas de Izalco pertenece a una sociedad capitalista que desconoce a fondo la sociedad fragmentada de El Salvador.

Identidad y discurso en Cenizas de Izalco de Claribel Alegría por Edith Dimo

The sentence "Menos obvia, sin embargo, es la intención de Alegría de establecer las identidades narrativas de las voces oprimidas" means that ________.

the author is writing from the women’s and the country people’s point of view, which are the least represented in literature
the book reviewer’s intent is to affirm that Alegría only wants to write about women and country people as Hispanic principles
Alegría uses a feminine narrator as the main character given that there are not many books with women as protagonists
there is an emphasis on the country people as the main character in the book, and in El Salvador society

Answers

Answer:

The answer is A "the author is writing from the women’s and the country people’s point of view, which are the least represented in literature "

Explanation:

I just took the test and got that answer right!!

Please Help!!!! Due today will give brainliest

Answers

Answer:

1) Mi mama lo vio

2) MI hermano lo tiene

3) Yo los veo

4) Yo lo necesito

5) Yo quiero tener lo

Explanation:

1-mi mamá lo vio
2-mi hermano lo tiene
3-yo los veo
4-yo lo necesito
5-yo lo quiero tener

que tipo de herramientas presentan mayor riesgos o alteraciones funcionales, las manuales o motorizadas

Answers

Answer:

Las manuales

Explanation:

Creo que es por que las motorizadas son controladas por una maquina y son casi perfectas, y el manual es controlado por un humano que no es perfecto

pleaseeeeeeeee helpppppppp

Answers

Answer:

1. sus

2. su

3. sus

4. nuestra

5. mi

6. tus

7. de

8. su

Explanation:

Complete the sentence with the correct conjugation ustedes____(ir) de paseo
Brainly points!

Answers

it’s Ustedes van de paseo

Espanol/Spanish speakers needed (Image is attached below) Please don't answer if you don't know. Thanks.

Answers

This are the questions with numbers
1 haremos
2 mira
3 lloverá
4decide
5 despegará
6 leo
7 llegará

What finally convinces Jeannette that she must leave , and that she must do so herself

Answers

We need more information in order to give a proper answer.

Answer:

what the heck are you talking about

Can someone please help

Answers

the correct term would be soy

Answer:

Soy

Explanation:

Because I took Spanish and had the same question two days ago

En el futuro Ud. será periodista. ¿Cuáles son algunos avances del mundo del futuro que
describirá en sus artículos? (Use el tiempo futuro en su respuesta).

Answers

only have to write If you were a journalist, what would you write?



aprovechamos las potencialidades de la zona para generar prototipos que promuevan el trabajo en las familias​

Answers

Answer:

siiiiii yooo cteoooooo

Entrega comida al estómago

Answers

food enters the stomach

The answer is Deliver food to the stomach

WILL GIVE BRAINLEST,ITS DUE TODAY
Complete the following dialogue with the appropriate responses. Use expressions that will show that you have sympathy for Rosa’s situation.

1. Rosa: Mi amiga ya no vive conmigo en Dallas, ella ahora vive en Nueva York.



2. Rosa: Mi hermano tiene un coche, pero yo no. Mi hermana puede comprar toda la ropa que ella quiere, pero yo no.



3. Rosa: Mi hermano pequeño siempre necesita toda la atención de la familia.



4. Rosa: No sé si va a haber una prueba en la clase de español mañana, pero voy a estudiar esta tarde.



5. Rosa: Mi hermana pequeña siempre entra en mi habitación sin permiso, usa mis cosas, y se pone mi ropa sin permiso.

Answers

Answer:

Que lastima que tu amiga te haya dejado sola en DallasEspero que ya pronto, con un buen trabajo que consigas, puedas tener el coche, la ropa y todo lo que quieras.Es tu hermanito y se comprende, mira ¡está precioso!.Si ponte a estudiar para que te vaya muy bien en el examen. Estaré, como siempre, orgullosa de ti.Ponle llave a tu habitación para que no pueda entrar.

Explanation:

¿Dónde puedo enviar cartas?
______________ cartas en la oficina de correos. (enviar)

Answers

Answer:

envia  

Explanation:

In Act I of Twelfth Night, Olivia claims that she does not want to marry the Duke. How does this develop the plot of Twelfth Night?

Cesario comforts Olivia and a serious romance develops between the two characters.

The Duke sends Cesario to win Olivia's affection, but Olivia falls in love with Cesario.

The Duke discovers that Olivia does not want to marry him because she is in love with someone else.

Olivia becomes angry with the Duke and takes it out on Cesario when the Duke commands the page to visit Olivia.

Answers

Answer:

B

Explanation:

Answer:

it is b

Explanation:

Please select the word from the list that best fits the definition
Nunca con muñecas.
jugaba
estudiaba
dormía
estaba
cantaba

Answers

The answer is jugué because is in past of jugaba

¿Cómo se le llama a una de las zonas de conservación más famosas de Centroamérica?
a. Montevideo
c. cuestiones ambientales
b. Monteverde
d. la cordillera de los Andes
Please select the best answer from the choices provided

Answers

Answer:

b. Monteverde

Explanation:

Monteverde, Costa Rica.

Other Questions
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called what was explained by darwins theory of biological evolution John wanted to buy his favorite rubber shoes. Its original price is $105. He is lucky today because the shoes that he wanted to buy is 30% off the original price. How much will John pay now for his shoes? Find the value of x. Then find the mB and mC. Why/how did the Black Identity or Black Arts Movement influence visual art? Suppose the Federal Reserve sets the reserve requirement at 14%, banks hold no excess reserves, and no additional currency is held. Instructions: In part a, round your answer to 1 decimal place. In parts b and c, enter your answers as a whole number. If you are entering a negative number include a minus sign. a. What is the money multiplier People who choose not be part of either party are known as ______________.a.independentsb.conservativesc.moderatesd.liberals