please answer the question! i will give brainliest

Please Answer The Question! I Will Give Brainliest

Answers

Answer 1
The answer is third person limited

Related Questions

2. Which phrase from paragraph 1 provides the best clue for the
meaning of "monotone"?
A “no joy in his voice"
B “He answered my questions"
c"with every syllable"
D "he didn't want to be there"

Answers

A :)


the definition of monotone is a continuing sound, especially of a person's voice, that is unchanging in pitch and without intonation.

The phrase from paragraph 1 provides the best clue for the meaning of "monotone" is “no joy in his voice".Thus the correct option is A.

What is a Context clue?

Any kind of hint or idea reflects from the statements which helps the reader to understand the clear context in which the word is used refers to context clue. This clue helps the reader to determine the appropriate meaning.

The dictionary meaning of the word "Monotonous" is something that causes boredom due to repetitive action. It is considered as an idea or object that brings a lack of interest in an individual.

The phrase which provides a similar meaning as the clue given is  “no joy in his voice" which indicates that there is no interest in an individual which makes them feel happy or satisfied which reflects in their voice.

Therefore, option A is appropriate.

Learn more about Context clue, here:

https://brainly.com/question/20263792

#SPJ2

What is the Central Idea of 57 bus

Answers

The book's main theme is resistance to reductive binaries, whether it's good and bad, adult and child, or male and female. Hope this helps!!

HELP PLZzzzzzzzzzzzzzzzzzzzzzzzzzzz

Answers

Answer:

I believe the first one is the answer. I read an explanation online

Explanation:

I hope this helps, and thanks! BRAINLIEST PLEASE!

Answer:

The first choice: He describes the balloonman as a strange, "goat-footed character and depicts his capacity to attract children to him.

Explanation:

The goat footed balloon man is Pan, the god of fertility, and also of love/sex.  The balloonman is a p*dophile, as some suggest, and abusing kids, giving them “joy” but making them also dirty, and the injustice could be that the children sometimes find it sad that they bust these guys who abuse them, but also treat them really nice.

I need help with this question

Answers

Answer:

I believe the correct answer is C

Explanation:

honestly im jus waiting on my next zoom class to start so im sorry if it is incorrect but I hope it was helpful

Stop and frisk was designed to decrease crime and thereby increase peace in communities. Do you believe that stop and frisk succeeds or fails to promote peace? Why?

Answers

Answer:

Yes.

Explanation:

It fails.

It can be inferred that in a questionable situation an officer would likely frisk a suspect to ensure they are unarmed, however, in some cases where police have taken advantage of their position of power, women have been "frisked" even when it was uncalled for and they were quite clearly unarmed. In most cases it may make sense to frisk them, but not in all cases and thus it fails to keep the peace because it causes more crime through corruption of power.

Answer:

It succeeds.

Explanation:

“Police may stop a person if they have a reasonable suspicion that the person has committed or is about to commit a crime, and may frisk the suspect for weapons if they have reasonable suspicion that the suspect is armed and dangerous, without violating the Fourth Amendment prohibition on unreasonable searches and seizures.”

They only do this with sufficient cause. If a police officer sees a man that looks like he has a gun on his hip, he may stop and frisk him. This is what the above statement pertains to. When Liberals want to take away our American right to have guns, they are also going against what they think is police brutatlity and racial injustice when a police officer may stop and frisk someone. A house divided against itself can not stand, so when we are fighting against our police, and what they do, and then we are fighting against crime and trying to take away our guns so we cannot protect ourselves, isn't that just plain foolish? We cannot stand if we do not stand together.  

I hope this makes sense, and I hope this helps. Thanks! BRAINLIEST PLEASE!

place the steps of the writing process in order from first to last

Answers

Answer: Please mark me Brainliest!!!

Explanation:

Outlining, Prewriting, Drafting, Reviewing, and Publishing  

Hope this helps :^)

"Hercules the Mighty."
7. In Scene 1, the line “It’s like tickling a butterfly” contains *
5 points
A. a metaphor that tells you that butterflies are ticklish.
B. a simile that tells you that the lyre must be played gently.
C. symbolism that shows how lovely lyres sound.
D. hyperbole that emphasizes how easy it is to play the lyre.

Answers

I think the answer is B

In "The Hill We Cimb," Amanda Gorman uses various techniques to argue that while progress is a slow and sometimes painful “climb” up the “hill” of justice, it is possible if Americans work together to change our country for the better. Write an essay in which you analyze the choices Gorman makes to convey her argument.

Answers

Ay bro she explained information about how are country grew and improved and we had downfalls but we always come back irdk that much about that poem sorry

________ helps the reader to make sense of the information to which he/she is exposed. Formatting, Length, Organization , or Theme

Answers

Answer:

theme

Explanation:

Now that you know what a character trait is Think of what it isn’t list as many non examples as you can

Answers

Answer and Explanation:

Character traits are characteristics of the personality of an individual that is maintained from childhood to adulthood, in most cases, or that can be developed throughout life, even in unconscious ways. This was explained by Freud, who believed that happy and even traumatic experiences that occurred in childhood could trigger traits in the individual that would be maintained until adulthood, even if the individual did not remember these experiences.

Examples of character traits are courage, patience, aggressiveness, honesty, among others.

Manias, preferences, personal tastes, ways of walking and speaking, being studious, among others, are not examples of character traits.

Which of the following is a good speaking habit? Select all that apply.
O Keep your volce at an even monotone.
O Look audience members in the eye.
O Shuffle your feet when you get nervous.
O Stare at one spot that is removed from the audience.

Answers

Answer:

look audiance members in the eye

Explanation:

it shows confidence

DUE RIGHT NOW PLEASE HELP!!!!!

Answers

Answer:

C) Adult Wolves help feed the Mother

Explanation:

The adult wolves help feed the mother.

prepare a dialogue between shopkeeper and a customer in a fruit shop​

Answers

Answer:

fruit seller : Good morning , sir, May I help you?

Customer : Yes, I want to buy some mangoes, a watermelon and half kg for grapes.

fruit seller  : This watermelon is $8, the grapes are $1.89 per kg and the mangoes are $0.70 per each.

Customer : They are awfully expensive . Can you make them less costly?

fruit seller  : Sir, please make your choice. I will consider.

Customer : I will give you $6 for the watermelon, for the mangoes and $1.42 for the grapes.

fruit seller  : Okay, I can only give you the watermelon for $8.

Customer : Here, take the money and I will only take the watermelon.

fruit seller : Thank you, sir. Here you go.

Explanation:

hope this helps :p

~tsu-chan

So I need some context here. ( This is for a school project about the Black Lives Matter)

So I’m Jamaican and Hispanic (I don’t think that really matters) but Ive grown up in a Hispanic household for a long time and I haven’t been really exposed to my Jamaican side that much. What should I include about the BLM project? Like All Black Lives Matter or Including examples from slavery?

Answers

Answer: examples of slavery would help provide a point of view many people don't see, as well as all black lives matter. Mention how African Americans have been important in the history of the world. The achievements and goals set and made by them. How without them, this world would be very different.

Answer:

So, if this were me, I would give some examples of what has happened to black people before, and then i would talk about what has happened recently to cause people to protest and stuff again, and then end it with All Black Lives Matter.

Explanation:

Modern forms of Welfare States are the following:
O Some European countries and Nordic Model
O Cuba, Venezuela, China, and North Korea
O Iraq, Iran, and Afghanistan
O Republic of Congo, Somalia, and Rwanda

Answers

Hello, I believe the answer is C.)

_____means the writer's personality expressed through words.

Answers

Answer:

hi my name is Jeff and I like games

Answer:

Mood

Explanation:

In literature, mood is a literary element that evokes certain feelings or vibes in readers through words and descriptions..

why should every school have a libary​

Answers

Answer:

Because it will educate the children more.

Explanation:

Answer:

So more children get exposed to wonderful thing that is reading

Explanation:

reading at first is really boring and more like a chore than an activity. But thats not the case, reading is really fun you just need to find the right book. this is why every school should have a library so that those kids can have the opportunity to find their love of books. ☺

PLS ANSWER FAST WILL GIVE BRAINLY!!!!!!



In the book "The Outsiders"

In what ways are Cherry and Marcia different from each other?

Answers

Answer:

In addition to the physical differences between the two girls—Marcia was “cute,” but Cherry was “a real looker"—Ponyboy first realizes that Cherry and Marcia “weren’t alike,” by the way each girl handles the Coke Dally gives them.

Dally sees Ponyboy and Johnny at the movies with the two Soc girls and joins them. Dally thinks Cherry is attractive and he starts smart-talking her and saying inappropriate things to her. When he offers to bring everyone a Coke from the concession stand, Cherry is angry at the way that he has behaved and menaced them. She wants him to leave and tells him,

"I wouldn't drink it if I was starving in the desert. Get lost, hood!"

When Dally comes “striding back with an armful of Cokes,” and arrogantly says, “This might cool you off.” he hands one to each girl and their reactions are completely different. Cherry throws her Coke in Dally’s face, telling him,

"That might cool you off, greaser…”

Explanation:

While not as strikingly beautiful as Cherry, Marcia is small and cute with dark hair. Two-Bit normally goes for Greaser blondes, but he really hits it off with Marcia because they are so much alike. They both have the 'same scatterbrained sense of humor,'

PLEASE HELP!! i will love you forever omg
write a short scene, in first person showing a time you were underestimated.

Answers

Answer:

Hello how can I help you please

Answer:

After the school counselors had completed the presentation on high school courses and transcripts, I requested a minute's interview with one of them. 8th grade would soon be some foregone epoch in my life, a discarded fragment of my existence. At that instant, I had a pressing question concerning summer courses.

"I should like to engage in academics over the summer. I intend to take an advancement course in geometry... and one in biology. Who should I contact for further information?" I enquired. I gave a brief smile, but the counselor merely scowled in response.

"That will be too much for you," she responded scornfully. "We firmly discourage any such-"

My heart sank in disappointment, but I would not be deterred.

Explanation:

This is something that happened to me, but you can modify story to suit your purposes.

Many battles and wars (such as the one at Gettysburg), are commemorated by statues or monuments, with some areas preserved as monuments and national parks. Do you think this contradicts the message of "Grass"? In at least 200 words, explain your thinking and cite evidence from the poem to support your opinion.

!200 words!

Answers

Answer:

War is tragic, tribulatious, and cataclysmic; it should not be glorified; however, we should not forget the various and steep sacrifices that have been made for war. Memorials are there to honor the fallen and all those who have given a part of themselves to the occasion. Thus, no, these monuments and memorials that were enacted to honor those in war, do not contradict the message of "Grass," for it is there to bring light on the fact of how catastrophic war is.

-J.L.

Which transition words, in order, best fill in the blanks?
Every middle school English class should include a unit in which
students put on a play. L), this would give students a chance to
gain a deeper understanding of a piece of literature. L), it would
strengthen student bonds as the whole class worked together on the
production. It is true that not all students are comfortable onstage;
D), many backstage jobs would be available as well.
A. To illustrate; By comparison; lastly
B. Therefore, First; finally
C. Although; For example, in addition
D. First of all; Additionally, however

Answers

Answer: It’s D

Explanation:

Why is monitoring heart rate a common technique to determine exercise intensity?

Answers

Answer:

The harder and more intensive your exercise is, there needs to be a proportional amount of oxygen-rich blood circulating to supply your body with the needed oxygen to continue.

Explanation:

As you exercise, you start to use more oxygen because your body is doing more work. As you use your muscles, there is an acid called lactic acid that starts to form on your muscles that causes the burning sensation you feel. The harder your exercise , the more of lactic acid there will be. The oxygen helps to clear out this lactic acid, while still supplying your body with the oxygen it requires to all body parts so they can function properly.

Pls help!!!!
What joke does Shakespeare make in the NAME of the character Nick Bottom?
He's actually the "top man" of his theater group.
His name means "Nick Buttocks," "Nick Butt," or "Nick Bum."
There is no joke here; Mr. Fawcett made this up.
It's a complicated play on words, referring back to a Middle English pun; the
Middle English word "Bootum" mean "actor."
All of the above.
None of the above.

Answers

can you see my profile? my brainly is broken i can see everything except my profile page..

1. Matthew Henson was an explorer who didn't get credit during his lifetime for his ___________________. 2. Over and over, Henson traveled through the icy ___________________ of the Arctic. accomplishments, determined, expedition, frigid, wilderness

Answers

Answer:

The first blank is accomplishments, and the other one is wilderness.

Explanation:

Hope it helped!! :)

I really need help with this question

Answers

Answer:

With 100% certainty, I can say that the correct answer is C.

Explanation:

“It’s comforting to know Chris was here,” Billie explains, “to know for certain that he spent time beside this river, that he stood on this patch of ground. So many places we’ve visited in the past three years—we’d wonder if possibly Chris had been there. It was terrible not knowing—not knowing anything at all.

“Many people have told me that they admire Chris for what he was trying to do. If he’d lived, I would agree with them. But he didn’t, and there’s no way to bring him back. You can’t fix it. Most things you can fix, but not that. I don’t know that you ever get over this kind of loss. The fact that Chris is gone is a sharp hurt I feel every single day. It’s really hard. Some days are better than others, but it’s going to be hard every day for the rest of my life.”

Abruptly, the quiet is shattered by the percussive racket of the helicopter, which spirals down from the clouds and lands in a patch of fireweed. We climb inside; the chopper shoulders into the sky and then hovers for a moment before banking steeply to the southeast. For a few minutes the roof of the bus remains visible among the stunted trees, a tiny white gleam in a wild green sea, growing smaller and smaller, and then it’s gone. (203)

What effect do the words “abruptly,” “shattered,” and “percussive” have in the final paragraph above?
A.
They exemplify Krakauer’s tendency to overwrite.
B.
They mimic the intrusion of the helicopter through sounds.
C.
They draw in the reader emotionally.
D.
They illustrate the harsh reality of the Alaskan wilderness.
E.
They stand as a metaphor for Chris’ character.

Answers

Answer:

D

Explanation:

abruptly, shattered, and percussive are words that make the reader interested. This is important and they make sure the reader is attached to the story.

Answer:

B

Explanation:

The first 2 paragraphs were meant to be heartfelt and sentimental and then all of a sudden the helicopter comes to life. The words are used to mimic the intrusion that the helicopter made in real life.

what happened shortly before edward left dauntlss

Answers

Answer: Al fractured Edward's skull during fight training. Peter forced him to watch while Drew assaulted Myra. Jeanine had him arrested for the murder of an Erudite leader.

what would be the answer for this? help!!

Answers

Answer:

l think its letter D l think lang naman

What comparison does Emily Dickinson use in "Saturday Afternoon" to describe why the children are happy on Saturday?

Children are like a dangerous "mob."
School is like a "prison."
An adult who frowns is like a "foe."
A storm is like "solid bliss."

Answers

Answer:

The answer is the second one

School is like a "prison"

Explanation:

Because there is no school on Saterday and they don't like school.

I aslo got it right on my quiz.

The comparison that Emily Dickinson use in "Saturday Afternoon" is that School is like a "prison."

Why do US schools resembles a prisons?

The term Schools Look Like Prisons is one that is associated with US. schools. It implies that schools are Cold, institutional set up  that are very cheap and , fastest way for building.

Conclusively, Emily Dickinson use in "Saturday Afternoon" is that School is like a "prison." because it have every characteristics that prison has.

Learn more about prison from

https://brainly.com/question/9309937

Based on the information in the section entitled "Additional Features," which of these things can the Mini-Jukebox do? A) allow users to buy new music from the device B) show users what the cover of the CD looks like C) let users know if someone is trying to call them D) give users recommendations for music they will like

Answers

Answer:

b

Explanation:

Answer: b

Explanation:

Other Questions
Which level of government is allowed to conduct trials for treason?federal governmentOstate governmentO local governmentall levels of government The central government working with the state and local governments in an example of a _________________ system of government. Which word is spelled correctly? How do we teach boys to grow up to be men who respect women, and how do we teach girls to grow up and find a respectable man? Help pls thanks!!!!!!!!! Use the function below to find F(2).F(t) = 2x1/2^3t. 1/32O B.1/8O c.1/16OD.1/64 Can anyone figure this out? NO LINKS OR FILES . What event causes Lily to realize Rosaleen really loves her?A. Rosaleen stands up to T. Ray for Lily's pet. B. Rosaleen rescued Lily from a rabid dog.C. Rosaleen tells Lily "Happy Birthday!"D. Rosaleen asked to adopt Lily.The book is Secret life of bees. 100 POINTS AND A BRANILIES NO LINKS AND NO CRAZY ANSWER PLEASE FOLLOW THE DIRECTIONS choose your recipe and simplify the longer sentences into basic steps (make sure you have 5 positive commands and 2 negative commands). You may have to add some negative commands into the recipe if there aren't any what is the mRNA in TACCGGATGCCAGATCAAATC? What is the measure of A, the exterior angle of the triangle shown below?F. mA = 92, because 180 (50 + 38) = 92.G. mA = 272, because 180 (50 + 38) = 92 and 92 + 180 = 272. H.mA=78,because 5038=12and9012=78.J. mA = 88, because 50 + 38 = 88. One of the biggest challenges that we all face, at least inmy opinion it's a challenge, is making difficult decisions,life-altering decisions. These decisions are not onlydifficult to make, but they can also bring consequencesthat are not easy to live with. However, if decisions are wellthought out and carefully considered they will be easier tomake and easier to live with.What feedback would be most helpful feedback to give the writer of thisparagraph?A. Improve the spelling and grammar.B. Make the claim more personal.C. Revise the claim to make it clearer.D. Address a counterclaim. What is the surface area of the figure? 408ft^2 458ft^2 545ft^2 720ft^2 Driving instructors Mr. Adams and Mr. Bateman teach class independently of each other. Among Mr. Adamss students, 68% pass the driving test on the first try, while 74% of Mr. Batemans students pass the driving test on the first try. Suppose there are 40 students in Mr. Adamss class and 50 students in Mr. Batemans class. Let A = the proportion of students who pass the driving test on the first try from Mr. Adamss class and B = the proportion of students who pass the driving test on the first try from Mr. Batemans class. What is the probability that Mr. Batemans class has more students who pass on the first try?Find the z-table here.0.2660.5470.7340.765 plsss help (will report if scam) John mows 3 of his neighbors yards for $20 a yard. How much money did he make? Sculptural reliefs at Angkor Wat depicting the Churning of the Ocean of Milk suggest that the patron of the complex may have intended to intimidate his audience by depicting acts of violence intended to intimidate his audience by depicting acts of violence A aimed to produce a large number of heirs for posterity aimed to produce a large number of heirs for posterity B desired to become godlike by achieving immortality desired to become godlike by achieving immortality C sought to gain enlightenment through meditative practices Can you please help me How is inverted syntax used as a rhetorical device? Milo drinks 2/5 of a bowls of water in 1/3 of an hour. How many hours will it take Milo to drink an entire bowl of water?