Answers
Answer: Carbohydrates
Explanation:
Related Questions
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answers
Answer:
1 and 5
Explanation:
https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question
Answer:
1.ATTAGC(ATACTAC)GGGC
5. ATGAATGC(ATACTACC)GGGC
do gases sink or float
Answers
answer
the density of gases depends upon the temperature. The higher the temperature, the more the molecules are spread out and the lower the density as shown in the graphic on the left. The result is that warm gases rise and cool gases sink.
Explanation:
Answer:
It depnds on howw dense they are
Explanation:
If they are denser than air then they sink. If they are less dense then they float.
3. How does ATP provide energy to your body?
Answers
Answer:
ATP(or Adenosine Triphosphate) provides energy to your body because it is a chemical that takes energy from the food you eat and turns it into energy your body can absorb. So because of this, it is considered a source of energy.
what is the major nitrogen nous waste in humans
Answers
Explanation:
urea
SUMMARY. Two major nitrogenous waste products, urea and ammonium (NH4+), are produced in humans when proteins are oxidized, and in this manuscript their excretions are examined from two perspectives.
Click on "Embankment dam at a gold mine." Of the two opinions to consider in this case, which one presents a stronger argument? How does that help you make your final decision as the consulting dam engineer? What was your decision for this dam, as the consultant? How can you accomplish this and still stay within your budget? (Site 1)
Answers
Answer: The strongest argument is the one that refers to security of people. This helps me to make a final decision, to ensure that there will be no accidents and guarantee that the mine will be used to generate moeny. So my decision is to repair it but choose to repair only the most urgent parts, to still stay within the budget.
Explanation:
A gold mine is a place where gold is extracted from the ground. Because of its value, the extraction of gold generates economic and social benefits all over the world, which has made this activity one of the most important in the world. There are also many ways of extracting this mineral.
The best argument will be the one that indicates the greatest concern for the safety of the citizens of that city or town. If there is a dam, it should be repaired in the best possible way. This will ensure the safety of the town and guarantee that the mine continues to be used, to generate economic benefits. Then, if the gold mine continues to be used even if it is not productive as it was, it must be repaired. However, in order not to make large expenditures and have a low budget for repair, I can choose to repair only the most urgent or necessary part.
So, the strongest argument is the one that refers to security of people. This helps me to make a final decision, to ensure that there will be no accidents and guarantee that the mine will be used to generate money. So my decision is to repair it but choose to repair only the most urgent parts, to still stay within the budget.
1)What is it about the structure of ATP that contributes to its ability to act as an energy currency?
2)When a phosphate is transferred from ATP, it can phosphorylate another molecule. How could this assist in allowing a protein to transport molecules against their concentration gradient?
Answers
Answer/Exlanation:
1) ATP (adenosine triphosphate) can be hydrolyzed such that it loses a phosphate group to form ADP (adenosine diphodphate). This is called ATP hydrolysis. This property allows ATP to act as energy currency because ATP hydrolysis releases the energy stored in the high energy phosphate bond.
2) Transporting molecules against their concentration gradient requires energy. When ATP loses its phosphate group, it can phosphorylate another molecule. This converts the molecule into its active state, giving that molecule the energy to pass through against the concentration gradient.
1) The ability of the ATP compound structure to act as an energy currency has been explained in the answers.
2) The method used by ATP to allow protein transport molecules against their concentration gradient has been explained below.
1) ATP is an acronym that stands for Adenosine triphosphate. This compound called ATP is divided into three phosphate groups with phosphate bonds that possess very high energy. Now, when water is added to ATP, the phosphate bonds that possess high energy will be broken down thereby releasing energy and producing adenosine diphosphate (ADP).
2) We saw above that when ATP undergoes hydrolysis, the phosphate bonds are broken down to form ADP and releases energy. However, it can undergo further phosphorylation to form another molecule which becomes energized when it goes to a higher energy state.
Now, In this higher energy state it gets to, it will be observed that the protein will possess enough energy to transfer molecules against a concentration gradient that requires energy.
Read more at; https://brainly.com/question/18116896
HELP PLEASE!!! please keep it short
According to the sliding filament theory what happens to the sacromere during a muscle contraction?
Answers
Answer:
A muscle fiber will contract when myosin filaments pull actin filaments closer together and thus shortening sarcomeres within a fiber.
What is an apex predator?
a) A consumer eaten by no other species
b) A producer of the highest nutritional value
c) A consumer living at the top of a mountain
d) A consumer that eats more than one species
Answers
what controls traits and inheritance
Answers
Answer:
In the explanation. :)
Explanation:
An organism's traits are controlled by the alleles it inherits from it's parents. Some alleles are dominant, while other alleles are recessive.
Hope this helps. Have a great day!
what structures found in the nucleus contain the genetic information of an organism
Answers
the nuclear envelope is a double membrane of the nucleus that encloses the genetic material it separates the contents of the nucleus from the cytoplasm the nuclear envelope is made of two lipid bilayers and membrane in an outer membrane
Explanation:
step-by-step explanation
According to Jefferson, a government must _____.
A) hold free elections every four years
B) tax its citizens only with a valid reason for doing so
C) respect the rights of its citizens or risk being overthrown
D) provide security for its citizens in the form of a strong military
Answers
Answer:
C) respect the rights of its citizens or risk being overthrown
Explanation:
in cell A, what is the structure labeled X?
Answers
Answer:
Yo i dont know but when someone does please help me bro
Explanation:
In cell A, the structure labeled X is a centriole.
Centrioles are cylindrical organelles found in animal cells, usually existing in pairs called the centrosome. They play a crucial role in cell division by organizing and forming the spindle fibers during the process of mitosis and meiosis.
Centrioles are involved in the separation of chromosomes, ensuring that each daughter cell receives the correct number of chromosomes.
Additionally, centrioles are essential for the organization of microtubules in the cytoskeleton, which provides structural support and maintains cell shape.
Their function in cell division and cellular organization makes centrioles vital components of animal cells.
Know more about centriole:
https://brainly.com/question/909799
#SPJ6
Structure that organizes motion of the chromosomes?
Answers
Answer:
Structure that organizes motion of chromosomes. Cytoplasm. Material in cell; contains chemical wealth: sugars, amino acids, and proteins a cell uses to carry out everyday activites. Vacuole. Saclike structure (large in animal cell); stores water, salts, carbs, and proteins. Plays a role in disposing waste.
Explanation:
There are various structures that are found present in a cell. And these structures have peculiar functions they carry out in the cell. Chromosomes are found in the nucleus of a cell. During cell division there is the needed movement of the chromosomes.
The structure that organizes motion of the chromosomes is the centriole
The centriole is a structure found in the animal cells near the nucleus that aid in the movement of chromosomes through the action of the microtubule and spindle fibres. They help to assemble these microtubules and spindle fibres to aid movement of chromosomes.Learn more: https://brainly.com/question/24552946
Which statement describes one feature of chemical changes? They never change a substance’s properties. They change a substance’s identity. They can usually be reversed. They keep a substance’s arrangement of atoms the same.
Answers
They change a substance’s identity.
Answer:
They change a substance’s identity.
Explanation:
What are the genotypes of the F1 parent plants?
Answers
do woody stems die off each winter and grow back the next spring
Answers
no they can survive the winter
1. How does adaption help the animals?
Answers
Answer:
Explanation:
A sobrevivir
Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule
Answers
____________ is a gas that makes up 78% of the earth's atmosphere.
Answers
Answer:
Nitrogen
Explanation:
Nitrogen makes up 78% of the atmosphere, while oxygen makes up only 21% and other gases make up around 1%
Answer:
nitrogen
Explanation:
It's a mixture of different gases. The air in Earth's atmosphere is made up of approximately 78 percent nitrogen and 21 percent oxygen.S
hope it helphow long does it take a p-wave to travel 5,200 km?
Answers
Eight minutes twenty second
Explanation:
Feedback
What is RNA and list and explain the 3 different types of RNA.
Answers
Answer:
RNA is Ribonucleic acid
mRNA
rRNA
tRNA,
Explanation:
mRNA, or messenger RNA, that serve as temporary copies of the information found in DNA; rRNA, or ribosomal RNA, that serve as structural components of protein-making structures known as ribosomes; and finally, tRNA, or transfer RNA, that ferry amino acids to the ribosome to be assembled
A cell membrane has permeability, which means that the membrane:
Answers
Answer:
transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.
Explanation:
I barley know what your trying to say
Like nutrients and water, energy also recycles through an ecosystem,True Or False?
Answers
Answer:
Explanation:
True
Which of the following measurements is the most precise?
165mg
O 164.5mg
164.47mg
Answers
Answer:
164.47mg
Explanation:
Precise means the most accurate
Which is true about all unicellular and multicellular organisms?
O They are made of one cell.
O They reproduce.
They cause infections.
O They are made of multiple cells.
Answers
what element must a molecule contain to be considered organic?
Answers
Organic compound, any of a large class of chemical compounds in which one or more atoms of carbon are covalently linked to atoms of other elements, most commonly hydrogen, oxygen, or nitrogen. The few carbon-containing compounds not classified as organic include carbides, carbonates, and cyanides.
hope this help!
Urey and miller cooked a "primordial soup" with Hadean gases, water snd electricity to make _____,_____,_____ and_____
Answers
Answer:
Urey and miller cooked a "primordial soup" with Hadean gases, water and electricity to make glucose, acetic acid, amino acids and lipids.
Explanation:
In the Miller-Urey experiment, the aim was to reproduce the conditions of the earth before the existence of life, with the objective of demonstrating the formation of organic matter from inorganic molecules.
The scientists took water and gases present in the Hadean eon —previous to the existence of life— such as methane, carbon dioxide, hydrogen, nitrogen and even ammonia, the primordial soup. This mixture was subjected to electrical discharges, inside closed containers.
The results were some organic molecules, including glucose, acetic acid, amino acids and fatty acids. In these results the presence of macromolecules, such as proteins or nucleic acids, is not appreciated, however it was a significant contribution to the knowledge of the origin of life on earth.
science is so confusing to me!
Select all answers that are correct.
If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:
the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself
Answers
Answer:
second one.
Explanation:
not sure but it's the only answer that goes with the other laws
The burrowing owl is found in dry, open areas such as grasslands, prairies, savannas, deserts, farmlands, golf courses, and urban areas throughout most of western United States and Florida, Central America, and most of South America. It makes its home in burrows of other animals and primarily eats insects and small rodents. As humans build more cities, nearby burrowing owl habitats change due to destruction of burrows and loss of prey. Which is the least likely outcome of the habitat changes that are described?
Answers
Answer:
inside under ground holes in the ground
Explanation:
Answer:D
Explanation:
A person who is optimistic:
O A. will make more money.
O B. believes that others control his or her fate. .
O C. will have successful relationships.
O D. will be healthier.
Answers
Answer:A
Explanation:
because optimistic people are confident about their future
Optimistic people believe that they will make more money. Therefore, option A is correct.
What is an optimistic person?A person who is very confident and hopeful about his future and hopes for good outcomes is known as an optimistic person. They have faith in themselves and believe that they have the skills to make everything good. Optimists are happier than pessimists.
An optimistic person sees the positive side of everything. They believe their faith is in their own hands, and no one can control it. Their point of view is always positive. There are two types of optimistic people and that are comparative optimism and nihilistic optimism.
They believe that they will be successful and make more money in the future. Therefore, option A is correct.
Learn more about optimistic people, here:
https://brainly.com/question/14920129
#SPJ2
