NO LINKS!!!!!! Help its urgent, PLEASE HELP!!!!!!!!!!!!!!!!

NO LINKS!!!!!! Help Its Urgent, PLEASE HELP!!!!!!!!!!!!!!!!

Answers

Answer 1

Answer:

Dairy

Explanation:

the Apple is the fruit, the string beans are the vegetable, and the chicken breast and whole wheat rice are proteins


Related Questions

What are 2 community resources for teens?

Answers

Answer:

schools

youth facilitys

police department

counsling facilitys

online helplines

Explanation:

NO LINKS!!!!!! Help its urgent, PLEASE HELP!!!!!!!!!!!!!!!!

Answers

Men’s s snemskksnsnnsnsmsmmsnsnsnsnnsnsnsnnsndndndnendnnskskdmdnndnns

Explain why setting limits can help you make responsible decisions.
(Complete sentences)

Answers

Setting limits helps you make responsible decisions because when you set limits you know how far you should or shouldn’t go.
Hope you get this right and make a 100

Urgent plz help!
Arrange the basic problem-solving steps in the correct order.
Implement the solution.
Make a choice.
Evaluate alternatives.
Gather information.
+
Evaluate the results.
Identify the problem.

Answers

Answer:

1) Identify the problem 2) Gather information 3) Evaluate alternatives 4) Make a choice 5) Implement the solution 6) Evaluate the results

Explanation:

not 100% sure on this one especially number 3 maybe ask some friends

how many pregnancies per 100 women may occur in a year while using the patch​

Answers

If you use it perfectly, the patch is 99% effective. But people aren't perfect, and it can be easy to make a mistake. so in reality, the patch is about 91% effective. That means about 9 out of 100 patch users get pregnant each year.

Steal the Flag Rules: Question 1
You can get out on your own side if your flag gets pulled while holding
the ball.
True or false

Answers

Answer: true I believe it depends on the school.

No I think the answer is False

Pls help asap thx
20.
21.

Answers

Answer:

20 = e

21 = c

Explanation:

Amino Acids are linked together to create a complete...
A: Mineral
B: Carbohydrate
C: Protein
D: Fat

Answers

Answer:

i want ma points 111111

Explanation:

Amino Acids are linked together to create a complete protein

1) What is your biggest struggle with your own mental wellness?
2)Are there certain triggers which ignite this struggle?
3)How adept are you at reflecting and evaluating
my own mental wellness?

Answers

1) for me it’s my self-esteem I have like really low self-esteem
2) when somebody like jokes about like how I look or how I act
3) I am not very good at reflecting or evaluating but that is something that I’m working on

Also I’m pretty sure they’re talking about your own mental wellness but you can use mine as an example

Answer:

Just answer this how you feel.

Explanation:

If some random person answers this, then they won't be getting what they want from you. If none of these apply to you, just say no. But if they do, then just write it down. No one can answer this besides yourself. Good luck.

Write about a problem-solving strategy that you’ve used at school or at home and describe the outcome.

Answers

A strategy I have used to calm my self down if a get really mad is to count down from ten, and to take a breath after each number I say. This helps me not feel angry anymore, so there was a positive outcome.

Answer:

Sometimes when I’ve made plans to meet my friends, my parents want me to babysit my little sister because they have plans to go out. I don’t want to cancel on my friends, so I apply the following problem-solving strategies:

Define the problem: I have a schedule conflict. I made plans with my friends, but my parents need me to babysit my sister.

Analyze the problem: My parents have to go out and so do I, but someone has to stay home to watch my little sister. My parents pay my allowance, and thus that someone will have to be me.

Establish goals: I want to be able to meet my friends, but I also do what my parents need me to do—babysit my little sister.

Come up with possible solutions:

Reschedule to meet my friends before my parents have to leave or after they get back home.

Ask my parents if they can reschedule so I can babysit my sister another day and don’t have to change my plans.

Take my sister out with me when I go to meet my friends.

Have my friends come over to my home.

Analyze and implement likely solutions:

My friends can’t meet earlier, but it’s a school night so we can’t meet later or we would be out too late. (Eliminated)

My parents cannot change their plans. (Eliminated)

If I take my sister out with me, I would have to get back home before her bedtime, but I would at least be able to meet my friends. (Likely)

My friends could come over so we could still meet and I could still babysit my sister. (Likely)

Explanation:

PLATO

NO LINKS!!!!!! Help its urgent, PLEASE HELP!!!!!!!!!!!!!!!!

Answers

Ikr people been putting links and I don’t like it either

According to federal dietary guidelines which of these foods is overconsumed?

A) Green Beans
B) Red Meat
C) Whole Grains
D) Orange Vegetables

Answers

Answer:

c

Explanation:

the answer is C i think

Yolanda and Chris have been doing well developing their financial plan. They have looked at their current resources, Identified short- and long-
term financial goals, and Identified potential goals. They are not sure what they need to do next. What is the BEST action for them to take in
order to continue the financial planning process?
O A. Ask other young married couples about their own financial troubles.
OB. Stop worrying about small financial decisions and start focusing on the big financial decisions.
Oc. Decide on a course of action and begin implementing their chosen paths to the goal.
OD
Make several emotional financial decisions by acting on their impulses.

Answers

Answer:

C. Decide on a course of action and begin implementing their chosen paths to the goal.

Explanation:

tis the correct answer on PLATO

Answer:

It is C for plato

Explanation:

The person _________ the golf hole shoots or putts first.
third from
farthest away from
second from
closest to

Answers

Answer:

Farthest away from is the answer.

Hope it helps!!!

PIM is computer technology that is used to:

A.) provide a personal intelligent monitor of the patient.
B.) give the health-care worker a private information map of the patient.
C.) trace a patient’s billable medical procedures by medical coding.
D.) record, store, and track patient information.

Answers

Answer:

d. record, store, and track patient information

Explanation:

Minerals are essential nutrients that?

A.regulate vital body functions
B.can come from living sources
C.all of these are true
D.can come from non-living sources

Answers

☁️ANSWER:

Minerals are essential nutrients that?

A.regulate vital body functions

B.can come from living sources

C.all of these are true

D.can come from non-living sources

☁️WHY...?

All the choices there are true because minerals truly regulate body functions and can come from iving or non-living sources.

☁️ Authentic Answer

☁️ 좋은 하루 되세요 !!

❤︎ PeachyBuns ❤︎

The government agency responsible for worker safety is _____.


A. OSHA

B. the FDA

C. the USDA

D. the FBI

Answers

OSHA....Occupational safety and health administration
The answer is A. OSHA

Participating in regular exercise

1. causes stress levels to increase
2. creates harmful stress
3. has no influence on stress levels
4. helps the body handle stress

Answers

Answer:4. helps the body handle stress Explanation: It can help it due to it being relaxing.

the answer is number 4

In which of Piaget’s stages does a child begin to pretend and ask questions? A. concrete operational B. sensorimotor C. preoperational D. formal operational

Answers

Answer:

C

Explanation:

The preoperational period is divided into two stages: The Symbolic Function Substage occurs between 2 and 4 years of age and is characterized by the child being able to mentally represent an object that is not present and a dependence on perception in problem solving. The Intuitive Thought Substage, lasting from 4 to 7 years, is marked by greater dependence on intuitive thinking rather than just perception (Thomas, 1979). At this stage, children ask many questions as they attempt to understand the world around them using immature reasoning. Let’s examine some of Piaget’s assertions about children’s cognitive abilities at this age.

Pretend Play: Pretending is a favorite activity at this time.

Answer:

C. preoperational

Explanation:

Edg. 2021

The main goal of a marriage and family therapist is to _____.



improve lifestyles


improve relationships


improve educational levels


improve marriages

Answers

improve relationships

What do healthier citizens do for the nation?
A. improve the economy
B. spend more money
C. vote more
D. create jobs

Answers

A is your answer :))

Although Mark begins administering first aid when he notices his 8-month-old
son coughing, his son becomes unconscious. What should Mark do next?
D. Mark should call 911 check for airway blockages and begin mouth to mouth breathing

Answers

Answer:

Mark should call 911 and then should start infant CPR and after each set check for anything in the mouth before doing rescue breaths.

Explanation:

^^

The correct answer is: “Mark should call 911, check for airway blockages, and begin mouth-to-mouth breathing.”

Explanation: I did my study and took the test - this was right :)

The act of making judgmental or opinionated remarks about a person, place or thing to another is:

1. deconstructive criticism
2. racism
3. prejudice
4. criticize

Answers

Answer:

Prejudice

Explanation:

ty guy in comment

Answer:

3.Prejudice

Explanation:

This is where adverse judgement or opinion are formed without knowledge of facts.

write sentences on each of the following begin with "there is "
a) your school
b) your room
c) your village/ town
d) your flower garden ​

Answers

There is your school
There is your room
There Is your village/ town
There is your flower garden

1. There is your school.
2. There is your room.
3. There is your village. There is your town.
4. There is your flower garden.
:)

How does Ebola compare to other potential zoonotic diseases like SARS coronavirus, bird flu, or MERSA?
I’m so sick of getting bots on here. I haven’t gotten a real answer to the past ten questions I’ve asked because of them.

Answers

Answer:

You get similar symptoms.

Explanation:

You will get flu like symptoms from Ebola, Coronavirus, SARS, etc.  Examples: Fever, chills, headache.  However, Ebola is much more dangerous.

And yes, bots are everywhere now. :(

When you make up for lost exercise time by increasing your workout intensity very quickly, you may
tend to lose weight
tend to stay motivated
reach your goals much faster
tend to stop exercising

Answers

tend to stay motivated (also nice venti pfp)
Tend to lose weight most likely

This bicycle emphasis is on speed and performance.
sport bike
road bike
mountain bike
race bike

Answers

In race bikes the emphasis is given to speed rather than comfort. Therefore, option (D) is correct.

What are race bikes?

A racing bicycle, often known as a road bike, is a type of bicycle that is specifically built to be used for competitive road cycling. Competitive road cycling is a sport that is organized by the Union Cycliste Internationale and played according to the regulations of that organization. Bicycles built for racing are optimized for optimal performance while yet adhering to the rules set forth by the UCI.

When it comes to race motorcycles, speed, rather than comfort, is typically prioritized. You can anticipate a frame that is more rigid and handling that is incredibly responsive. When additional speed is desired, the gearing is typically increased. The wheels are either of the thin, lightweight variety or the carbon-based, aerodynamic variety.

Learn more about race bikes, here:

https://brainly.com/question/29538312

#SPJ6

what is not suggested for promoting flexibility

Answers

Answer:

Ahhhhhh we have the same name and You should not flex more then you can because you could break a bone or damage you flexibillity

Explanation:

it is more that you should not stretch further than your body allows you because you don’t want to pull a muscle or tendon

1. The amount you tan or burn while in the sun depends on the amount of _______ in your skin.

A. melanin B. blood vessels C. fat D. hair follicles

2. _______ in your skin helps you feel sensations.

A. Sweat glands B. Nerve endings C. Fat D. Connective tissue

3. Sunburns and skin cancer are attributed to _______ radiation exposure.

A. UVA B. UVB C. UVC D. UVA and UVC

4. A condition that is not caused by exposure to UV radiation is _______.

A. wrinkles B. leathery skin C. acne D. brown age spots

5. Doctors recommend using sunscreen with an SPF of at least _______ on a daily basis.

A. 15 B. 30 C. 45 D. 60

6. The sun’s rays are strongest between 10:00 AM and _______.

A. 1:00 PM B. 2:00 PM C. 4:00 PM D. 5:00 PM

7. When exposed to sunlight, the ______ thickens to block out UV rays.

A. epidermis B. sweat gland C. dermis D. subcutaneous tissue

8. The amount of sunburn a person gets depends on his or her ______ and ability to produce melanin.

A. weight B. height C. vision D. pigmentation

9. People with severe sunburn can experience each of the following symptoms except _______.

A. tendonitis B. fever C. chills D. weakness

10. _______ is effective in filtering out the sun’s harmful rays.

A. Snow B. Cloud cover C. Clothing D. Water

11. Thick ointments with zinc oxide that help block sunlight from the skin are called ______.

A. sunscreens B. sunblocks C. moisturizers D. chemical peels

12. After sunburned skin peels, the new thin and sensitive skin that appears must be protected from the sun for several _______.

A. hours B. days C. weeks D. months

Answers

Melanin , Nerve endings,  UVB rays, leathery skin, 30, 4:00pm, Epidermis, Pigmentation, Tendonitis, Cloud cover, sunscreens, weeks are the right answers in the following fill in the blank respectively.

What are UV radiations?UV radiation is a kind of non-ionizing radiation released by the sun as well as artificial sources like tanning beds. While it has certain advantages for individuals, like as the production of Vitamin D, it may also be harmful to their health. The sun is our natural source of UV radiation.Harmful effect of UV raysUVB rays have a minor advantage over UVA rays in terms of energy.They are the principal rays that cause sunburns because they may directly damage the DNA in skin cells.They are also suspected to be the cause of the majority of skin malignancies.UVC rays have a higher energy level than other UV rays.Sunburns, skin cancer, ageing, and snow blindness (a sunburn to the cornea that causes a temporary loss of vision) are all caused by UVB rays, which can also reduce your body's capacity to fight sickness.Prevention of UV radiationShade your face, head, ears, and neck with a wide-brimmed hat. Wraparound sunglasses that prevent UVA and UVB rays are recommended. For UVA and UVB protection, use sunscreen with a sun protection factor SPF of 15 or greater i.e. 30. Indoor tanning should be avoided.

Hence, the correct options are A,B,B,B,B,C,A,D,A,B,A,C respectively.

To know more about UV rays here

https://brainly.com/question/6501011

#SPJ2

Discuss two ways in which cultural views that axist may affect a relationship negatively.

Answers

sshesssbb
i’m going into noght
Other Questions
How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest Select the correct responses: Cules son los 3 usos de se mencionados en el video?Question 10 options:Los pronombres de doble objetoVerbos como gustarEl "se" impersonalLos pronombres demonstrativosEl "se" transitivoVerbos reflexivos y recprocos Please help me with 1,2,3,4,5,6,7,8,9,10,11 please I really need help explain how the genus and species name of an organism is properly written Explain what benefits you can achieve while performing either exercise? I needddd helppppp !!!whats the answer ? Which linear equation is written in slope-intercept form? Does the timing of a tsunami affect its impact? A 1.5m tall boy casts a 3m shadow. Calculate the height of a tree that simultaneously casts an 8m shadow.