Name a time a friend peered pressured you to do something you didn’t want to do

Answers

Answer 1
i was peer pressured into sneaking out at night because my friends called me lame for not wanting to because of how much trouble we could’ve gotten into

Related Questions

I need help!!!!!!!!!!!!!!

Answers

Answer:  48

Explanation: 8x6

please help me please will give ​

Answers

Answer:

1) C
2) B
3) C
4) I don’t see the 4th question in the picture.
5) B
6) D
7) D
8) A

Answer:

1. C

2. B

3. C

4. Cant see #4

5. B

6. D

7. D

8. Cant see answer choices

Explanation:

Add a message with #4 and the rest of #8 if you want the answers :)

Which of the following choices is a fuzzy signal word?

Answers

Answer:

there is no following choice ._.

Explanation:

In The Tragedy of Julius Caesar, which of the following events convinces Brutus that he was wrong to kill Caesar? a. his ethical disagreement with Cassius c. the mysterious death of Portia b. Antony’s reproaches of the killers d. the apparition of Caesar’s ghost

Answers

Answer:

Option D, In The Tragedy of Julius Caesar, the event that convinced Brutus that he was wrong to kill Caesar was the apparition of Caesar’s ghost

Explanation:

After killing Caesar, Brutus realized that his act of killing Caesar was not correct when he saw Caesar's ghost. While addressing the public, Brutus in his omen confirmed his mistake and by that time he decided to die.

Hence, option D is correct

5. Name an example from history when Americans were separated by an "us versus them" mentality.

Answers

Answer:

El Paso mass shooting is an example from history when Americans were separated by an "us versus them" mentality.

Explanation:

One example of "us versus them" mentality of Americans was the El Paso mass shooting.

The agenda of this shooting was to kill as many as "them" i.e Mexicans. This represents an extreme mentality where world is thought of to be divided into an us and a them. During the El Paso mass shooting several poster displayed this mentality in which there was a detailed plan to segregate America into territories by race.

In Act I, how does Romeo feel when he thinks about Rosaline?
A excited
B sad
C enraged
D nervous

Answers

Answer:

B. Sad

Explanation:

I majored in the Arts

In Act I, Romeo feel sad when he thinks about Rosaline. The correct option is B.

Romeo shares his unrequited love for Rosaline and talks about how depressed and broken he feels.

Rosaline is shown as being completely in love with him, but she refuses to reciprocate and has vowed to lead a chaste life.

Romeo's devotion to Rosaline is shown to be childish and founded on reading subpar love poetry.

Romeo's unrequited love for Rosaline serves as the catalyst for the play's events, which ultimately result in Romeo's meeting and falling in love with Juliet.

Thus, the correct option is B.

For more details regarding Romeo, visit:

https://brainly.com/question/33448027

#SPJ6

Imagery can be best described as language that
Contains a metaphor
Emphasizes the abstract
Appeals to the five senses
Uses an explicit comparison

Answers

Answer:

c

Explanation:

which word is acceptable in apa style format?
a. that's
b. etcetera
c. because
d. you​

Answers

C. Because

You should avoid words like “etcetera” and “that’s” because they’re informal. “You” simply should not be used unless you’re writing in 2nd person, as you probably learned in elementary school.

Refer to the article "The Value of Money" in your Money, Money, Money magazine for a complete version of this text.


Based on the reasons and evidence in the "Inflation" section of the text, which sentence best states a point made by the author?



"A little price inflation is good for an economy."


"When a good or service becomes scarce, its price goes up."


"More spending creates more demand for a product."


"Purchasing power measures how many goods and services you can buy for a certain dollar amount."

Answers

Answer:

"More spending creates more demand for a product."

Explanation:

According to the article "The Value of Money" in my Money, Money, Money magazine, the author writes about the theory of money and the various ways the circulation, printing and use of money affects everyone.

Based on the reasons and evidence in the "Inflation" section of the text, the sentence that best states a point made by the author is that "More spending creates more demand for a product."

Answer:

The Answer is C. More spending creates more demand for a product.

Explanation:

Hope this helps

One of the themes of "The Story of an Hour" is:

A.
the difficulties in marriage

B.
the empowerment of freedom

C.
the challenges of grieving

D.
the strength of the bond between sisters

Answers

I would say B

“Louise sees her life as being absolutely hers and her new independence as the core of her being.”

she feels free and enjoys this feeling of freedom.

Which type of folktale includes explanatory stories about different phenomena? A. Cumulative tale B. Pourquoi tale C. Tall tale D. Noodlehead tale

Answers

Answer:

B. Pourquoi tale

Explanation:

#PLATOFAM

plz help its due it 10n minutes
In a 8-10 sentences, how does the novel the hate u give relate to our society today?

Answers

Answer:

he author's portrayal of the shooting in the story and the events following– from media coverage to protests and riots–. relates closely to instances of police brutality that have happened in the real world. ... Stereotypical portrayals like this can be seen in the actual media. when referring to shootings like Khalil's he was just grabbing a brush.

The Hate U Give examines the way society uses stereotypes of black people to justify violence and racism against them. These stereotypes protect white communities, such as the students at Starr's school, Williamson Prep, from reflecting upon systemic racism, which perpetuates discrimination.

Explanation:

Answer:

he author's portrayal of the shooting in the story and the events following– from media coverage to protests and riots–. relates closely to instances of police brutality that have happened in the real world. ... Stereotypical portrayals like this can be seen in the actual media. when referring to shootings like Khalil's he was just grabbing a brush.

The Hate U Give examines the way society uses stereotypes of black people to justify violence and racism against them. These stereotypes protect white communities, such as the students at Starr's school, Williamson Prep, from reflecting upon systemic racism, which perpetuates discrimination.

Explanation:

What is the theme of growing by Jacob Henderson

Answers

Family duties is the theme of growing by Jacob Henderson.

What is theme?

A story's topic is its subject, but not in the way you may initially think. In contrast to a character or scene, a theme is not a literal component of the work. It is the main teaching the story tries to convey.

A few examples of theme topics include love, justice/injustice, family, hardship, the American Dream, money, and inhumanity. Some examples of themes are: People put their own identities at risk in the pursuit of love, human nature is corrupted by power, and justice cannot exist without compassion.

The theme of a fiction is the narrative's overarching subject matter. It is the argument the story's writer is trying to make. A general lesson about life is frequently the subject of a narrative. Theme is important in a story because it

Thus, it is Family duties.

For more information about theme, click here:

https://brainly.com/question/11108997

#SPJ2

The central idea of the short story "Growing" is giving to a good cause. The story's protagonist came to understand that there are numerous ways in which he might benefit the populace.

The story hinted at Nate's feelings when he was able to assist others.

The theme of a story is its subject, but not in the sense you might first suppose. A theme is not a literal element of the work, as opposed to a character or scene. It is the main lesson the tale aims to educate.

The overall topic matter of a fiction serves as its theme. It is the point the author of the narrative is attempting to make. A narrative frequently teaches a universal lesson about life.

Thus, this is the theme of the given story.

For more details regarding central idea, visit:

https://brainly.com/question/5990938

#SPJ6

A student receiving an honor was chosen to write an article to submit to the school board on the major influences in his education. Read the excerpt and answer the following questions.

I am honored to be receiving the Most Dedicated Student Award. In my years in Bellows Independent School District, I have had the pleasure of being taught by many inspirational educators.

I was afraid when I entered the third-grade classroom because I had recently moved to the area. In my previous school I had many friends and was known by all. The Bellows Elementary School seemed so enormous, cold and uninviting. My attitude quickly changed once I saw all the smiles of the other students. They simultaneously called my name and welcomed me to their class. Mrs. Sparrows immediately spoke to me, shook my hand and showed me to my seat. It seemed the entire day was focused on me being accepted and feeling a part of the school.

This feeling of belonging and acceptance has only grown stronger over the last eight years. Every teacher, principal, assistant, aide, janitor and secretary have all exhibited characteristics of positive attitudes, and excellent role models to every student.

Not solely in the classroom, but around the school, and in the community, I have seen first-hand the amount of work and time these professionals gave to their jobs.

Choose a transition sentence that would improve the flow between the first and second paragraph.
1. I loved school and we had just moved here for me to start third grade.
2. However, when I walked in on September 7, 2011, I did not feel that compassion and dedication that I now feel.
3. I entered this district when I started in 2011.
4. In many ways I always had been dedicated to this district.

Answers

Answer:

1 . I loved school and we had just moved here for me to start third grade

Archaeologists estimate the pits may contain as many as 8,000 figures, but the total may never

Answers

Answer:

To date, four pits have been partially excavated. Three are filled with the terra-cotta soldiers, horse-drawn chariots, and weapons. The fourth pit is empty, a testament to the original unfinished construction. Archaeologists estimate the pits may contain as many as 8,000 figures, but the total may never be known.

Explanation:

1) Odysseus was one of the heroes of the Trojan War. What has happened to him and his men on their return home? Why?

Answers

Answer:

Odysseus and his men journeyed for ten years to get back to Ithaca after the Trojan War.

This was because the men did things contrary to the orders of their king, Odysseus, leading the gods to delay their arrival home. By the end of the journey, none survived except Odysseus himself.

Explanation:

The Trojan War was one of the most significant wars fought in ancient mythology. And after the war, many of the warriors went back to their homes, among them Odysseus and his men from Ithaca.

But the journey of Odysseus and his men would take longer than most returnees. Theirs will take them a decade, encountering monsters and gods along the way. Their return journey is described in detail in the epic "The Odyssey" by Homer.

The delay in their arrival was because of the men's disobedience. They would do things Odysseus told them not to do, making the gods angry. This resulted in their punishments', like being stuck in the island of Circe, or being attacked by Zeus after they stole the Sun god Helios' cattle. By the end of the journey, only Odysseus survived to arrive at Ithaca, the rest being killed during the many encounters along the journey.

How are fact-checking and knowledge-based journalism different?

Answers

Answer:

Linda Greenhouse, winner of a Pulitzer said that journalists have  to do their best to provide not just the facts, but also — always — the truth.

Journalists should be as transparent as possible about sources and methods so audiences can make their own assessment of the information.

We are in a world of "expanding truth", where everyone who is knowledable about something, and has a bit of exposure, talks in the news about a trending topic. Facts should be checked. ALWAYS. That's what distingues knowledge-based from fact-checking. In one, the person speaks just because he/she has a knowledge about something, but most of the times, facts are not really checked.

Explanation: You're welcome!

Explanation:

Fact-checking and Knowledge-based journalism are different because when you fact-check, you are sure everything is right and ward off any potentially false info. When using knowledge-based journalism, you most likely know what you're writing is right, but it could potentially be wrong as your mind tends to twist things a bit.

A Christmas Carol - Charles Dickens

In chapter 2, the Ghost of Christmas Past takes Scrooge to see his past Christmas experiences. As Scrooge visits these events, he is able to see and hear but unable to engage with the people. Identify one place where this limitation creates a strange or humorous situation for Scrooge.

Answers

Answer:

Dickens create a funny effect in chapter 2 of A Christmas Carol when the Ghost of Christmas Past takes Scrooge to see Fezziwig’s party. This part of the story reveals how caught up Scrooge becomes in the festivities although they aren’t really happening:During the whole of this time, Scrooge had acted like a man. His heart and soul were in the scene, and with his former self. He corroborated, remembered,and  enjoyed everything, and went through  the strangest things. It was not until now, when the bright faces of his former self and Dickens were turned from them, that he remembered the Ghost, and became very concered that it was looking full upon him.

Explanation: 99% origianl

paraprased the sample answer

A funny moment in Chapter 2 is when Scrooge is having fun at a party that took place in the past and is an illusion.

Who is Scrooge?He is the protagonist of "A Christmas Carol."He is a greedy and bitter man.He is someone who has forgotten the meaning of Christmas.

To get Scrooge to change his behavior and actions, The Ghost of Christmas Past takes him to a party he attended as a teenager.

This is a funny moment in the book, as the party is an illusion based on Scrooge's memory, but he's having fun and partying like it's all real.

You can learn more about Scrooge at the link below:

https://brainly.com/question/7783677

i need help with this please

Answers

Answer:

I would like to say the answer is A) broken pair of glasses.

Explanation:

This is correct to me because if she cant see her trueself. Its inside the question, main word.. "see" thats why the answer is broken pair of glass. hope it helps.

Where do details about the inspections immigrants faced best fit in a presentation about the experience of coming to America? in a discussion of the experiences immigrants faced during their journey to America in a discussion of the experiences immigrants faced while going through Ellis Island in a discussion of the challenges immigrants faced after they arrived in America

Answers

Answer:

The details about the inspections immigrants faced best fit in a presentation about the experience of coming to America:

B. in a discussion of the experiences immigrants faced while going through Ellis Island.

Explanation:

Ellis Island was an immigrant station between the years of 1892 and 1954. Immigrants who had just arrived in America were supposed to be inspected in Ellis Island, undergoing examinations and interviews. Some got so nervous they were not even able to answer the questions. With that in mind, if we were to talk about the details of those inspections, the best place to do it would be in a discussion about the immigrants' experiences in Ellis Island.

Answer:

B

Explanation:

trust

Is the solution correct?

Answers

Answer: All answers are correct in that image.

Explanation: Good Job

Your answer is correct hood jod sweet

How does the
excerpt exemplify Gothic fiction?

Answers

Answer:

The excerpt exemplify gothic fiction by describing a scene of blood and gore. When we say Gothic fiction this is a kind of genre in writing that presents a combination of horror and fiction. It also includes the element of fear, death, and very intense or suspense emotions.

What is the purpose of the chart?

Answers

Answer:

The main functions of a chart are to display data and invite further exploration of a topic. Charts are used in situations where a simple table won't adequately demonstrate important relationships or patterns between data points.

Explanation:

please give me brainlist and follow

Answer:  A chart can help you with keeping track of things.

Explanation: It can help with math, science, english, health, and in daily life such as keeping track of your food logs.

HOPE THIS HELPED YOU, SORRY IF IT DIDN'T!

;D

Claudia has an idea for a documentary. She understands there are many steps she will need to take to make her film. What should she do first?

A. put together a proposal

B. create a storyboard

C. find funding

D. write a script

Answers

B is the best answer.

Who is responsible for Cassius’ premature death? IN JULIUS CEASAR

Answers

Answer:

...........

Explanation:

read the story i need the story to answer your question

6. Holden states he "was sort of thinking of something else while [he] shot the bull." What

was he thinking about?

Answers

This question seems to be incomplete. However, there is enough information to find the right answer.

Answer:

Holden says that, while shooting the bull, he was thinking about the ducks of a lagoon in Central Park, and what happens to them if the lagoon gets frozen.

Explanation:

In the second chapter of J.D. Salinger´s "The Catcher in the Rye", Holden says that, while shooting the bull, he was thinking about the lagoon in Central Park, New York, where he lived. He found himself wondering if the lagoon would be frozen over when he got home, and what happens to the ducks if that happens.

Select the correct answer.
Malik is considering this source for his research project. How could he best synthesize the information in the source?
OA. The shifting borders of America created opportunity for civil rights activism in the United States.
ОВ. .
Latino/a Americans are often portrayed in the Mexican Mural Movement.
OC. Latino/a Americans have been active in the establishment of civil rights in the United States.
OD
As advocates for civil rights in the United States, Latino/s encouraged safer working conditions.

Answers

Answer:

D- As advocates for civil rights in the United States, Latino/s encouraged safer working conditions.

Explanation:

right on plato/edmentum

The best synthesize the information in the source,As advocates for civil rights in the United States, Latino/s encouraged safer working conditions.

What is civil rights?

The civil rights are granted by governments to ensure civil liberties  without the civil rights, basically all civilians will live without any liberties because the governments will have too much power over their people.  Without civil rights, if you're a hindrance for  the government, they could easily just kill you like in North Korea.

Thus, option "D" is correct.

To learn more about civil rights click here:

https://brainly.com/question/1142564

#SPJ2

Read the claim. Schools should stop doing standardized testing. Read the counterclaim. The Department of Education says that teaching students to do well on standardized tests helps to motivate students and keep them focused on important subjects. Read the rebuttal. On the contrary, being forced to focus on testing stresses students and limits the amount of knowledge they can gain. How can the writer revise the rebuttal to make it stronger

Answers

Answer:

- by adding a statistic or a quotation.

Explanation:

A counterclaim primarily aims to neglect the previous claim of the author and it is added with the aim to establish both the stands on the topic. The given rebuttal can be made impactful by 'addition of statistical data or quotation' as it will help nullify the counterclaim effectively and establish the validity and credibility of the author's actual claim which will appeal to readers' logic and make them believe in it. A strengthened rebuttal helps establish the author's objectivity and unbiasedness and validates why he favors that specific stand of the topic. Thus, it displays the author's claim to be fairer and justified.

11. Hawthorne's reference to Lincoln as the man of men" (line 3)


A. given added importance by the "of course (line 1).


B. reinforcement for Lincoln's position of one

of the "statesmen" (line 1).


C. somewhat deflated by the preceding phrases in parentheses (line 3).


D. explained by the reference to "a private grief"(line4).


E. based on Lincoln’s "very remarkable physiognomy"(line 6)

Answers

Answer:

E. based on Lincoln’s "very remarkable physiognomy"(line 6)

Explanation:

Hawthorne's reference to Lincoln was made after he observed Lincoln during a session at the White House. Hawthorne realized that Lincoln had something different, something that other men did not, Lincoln's presence was so striking for him, that he described him as the "man of men." Hawthorne noticed that Lincoln's face was something very remarkable and impressive that gave him an air of importance and relevance. In other words, he believes that Lincoln's physiognomy is what makes him the "man of men."

Choose the two central ideas of the passage.

A. Cars have become safer, cleaner running, and faster over time.

B. The fastest cars are too expensive for the average person to buy.

C. The assembly line process made it possible for more people to buy cars,

D. People have used cars for both productivity and pleasure since the early 1900s.

E. Environmental concerns changed the way cars were designed and manufactured in the 1970s.

F. People need a clearer definition of "production car" and standard rules for certification before they can determine what is truly the fastest car.

Answers

Answer: I think the answer is A and D but im not sure.

Other Questions
How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable? The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)Air would not reach the bronchioles.Air would be trapped in the bronchioles.The lungs would over inflate.The lungs would lack the pressure needed to inflate. 8 yd6 yd15 yd10 ydAnswer:please help!:) After George learned that Mrs. Min suffered from schizophrenia, he mistakenly concluded that her tendencies to laugh easily and smile frequently were symptoms of her disorder. This best illustrates the: unreliability of the DSM-V unreliability of the DSM-V shortcomings of the medical model shortcomings of the medical model biasing power of diagnostic labels biasing power of diagnostic labels dangers of the biopsychosocial approach dangers of the biopsychosocial approach