Michelle has a bank account balance of $184. She deposits $38 and then spends $45 when she goes shopping.​ How is the amount of money Michelle spent shopping represented?
A. -45
B. -38
C. 38
D. 45

Answers

Answer 1

Answer:

A. -45

Step-by-step explanation:

We know that Michelle has a bank account of one hundred eighty four dollars, she then deposits thirty eight into her account, then goes shopping. Spending forty-five dollars. We are then asked the amount of money she spent being represented.

Our keyword is "spent" and "fourty-five". Why? Because these determine how much money is being taken away or added.

Since we know that spending money is decreasing the amount you have, then we would need a negative sign, and since we also know the amount she spended on is forty-five, that leads us to our answer being A. -45

Answer 2

Answer:

-45

Step-by-step explanation:

She uses $45 when she goes shopping so she is reducing her bank balance.


Related Questions

You and your friend decide to go to Red Robin to eat. You are both part of the rewards club and receive coupons in the mail. You have a coupon a coupon for 10% off the total bill. Your friend has a coupon for $5 off the total bill. Which coupon should you use to save the most money if the total bill was $29.90?

A. the $5 off coupon
B. the 10% off coupon
C. either one
D. cannot be determined

Answers

Answer:

B because if you use 10% off it would be less thN the 5% off one the other 2 answer make no sense

If θ is an angle in standard position and its terminal side passes through the point (5,-12), find the exact value of sinθ in the simplest radical form. need answer, please

Answers

9514 1404 393

Answer:

  sin(θ) = -12/13

Step-by-step explanation:

The distance from the origin to the given point is ...

  r = √(5² +(-12)²) = √169 = 13

For point (x, y) ⇔ (r; θ), recognize that (x, y) = (r·cos(θ), r·sin(θ)). This translates to ...

  sin(θ) = y/r

  sin(θ) = -12/13


Find the slope of the line connecting these points. (8,3) and
(21,3)


Answers

Answer:

m=0

Step-by-step explanation:

3-3/21-8

0/21-8

0/13

0

Answer:

(8, 3) (21, 3)

slope = change in y divided by change in x

slope = (3 - 3) / (21 -8)

slope = 0 / 13

slope = 0

Step-by-step explanation:

Pls help me solve this

Answers

the answer is B, because you multiply 2x2x2x2x2x3x3/(-3)x(-3)x4x4

The table shows the number of members at a gym each month from January to July

Answers

Answer: Please look at my work below!~

Step-by-step explanation:

Have a great rest of ur day!(^∀^●)ノシ

pls help me frens......

Answers

Answer:

V= 8

x=4.5

BCF =48 CFE=132

V=352.8 =8.4x8.4x5

For the volume one i cant read the number but if the bottom number is 8 then V=803.84

if its 6 then v = 452.16

Step-by-step explanation:

v= 2x2x2 v = 8

x is 11x-9=7x+9 | 4x=18 | x=4.5

15x=180 x=12 | CFE = 11x12=132 | BCF = 4x12=48

quais as raízes de:
(x^2)-(2^x)-1=0

Answers

Answer:

Step-by-step explanation:

quare cm
Read the following problems. Sketch each shape and label it.
Then, answer the questions, showing your work below each questions
(Gehad drew a square that has side lengths of 8 cm.
o
SU
The Perimeter =
The Area =

...
X​

Answers

P=32cm
A= 64cm^2

Step by Step

Formula(Perimeter): P=s+s+s+s
S=side P=perimeter
P=8*4
P=32

Formula(Area for Square): A=s^2
A=Area s=side
A=8^2
A=84

I NEED HELP PLEASE!!!

Answers

Answer:

9-8=1 times 2 = 2

Step-by-step explanation:

A group of nutritionists is hoping to show that a new soybean compound has more protein per gram than roast beef, which has a mean protein content of 20 grams. A random sample of 5 batches of a large supply of soy compound have been tested, producing protein contents of 15, 22, 17, 18, and 23 grams. Which of the following conditions have been met?
I. The data is a random sample from the population of interest.
II. The sample size is less than 10% of the population size.
III. The sample size is large.
a. I only.
b. I and II.
c. I, II and III.
d. II only.
e. III only.

Answers

Answer:

The data is a random sample from the population of interest and The sample size is less than 10% of the population size. ( b )

Step-by-step explanation:

roasted beef protein = 20 grams  ( mean value )

sample size of soybean compound = 5

mean value of their protein = ( 15 + 22 + 17 + 18 + 23)  / 5 = 19

The conditions that have been met are :

The data is a random sample from the population of interest. and

we can say the sample size is less than 10% of population size because we do  know the population size is a large supply

Which statement is correct?
A. Secant is the reciprocal of tangent.
B. Cosine is the reciprocal of cosecant.
C. Cotangent is the reciprocal of secant.
D. Cosecant is the reciprocal of sine.

Answers

B is the correct answer

help me pls i will give brainly

Answers

Answer:1/9

Explanation: Probability of landing on 9 is 1/3. Landing on 9 two times you multiply the probability twice. 1/3 x 1/3 = 1/9

Which expression is NOT equivalent to 8x ?​

Answers

Answer:

B

Step-by-step explanation:

7x + 1 isn't equal to 8x

For example:

Addition. In this equation, you can add all of the coefficients (2, 5, and 4) because the variables are the same (a).

2a + 5a + 4a = 11a

Subtraction. In this equation, you can subtract all of the coefficients (11, 5, and 4) because the variables are the same (a).

11a – 5a – 4a = 2a

An architect is designing square windows with an area of(x2 + 16x +64) ft?. The dimensions of the
windows are of the form ax +b, where a and b are whole numbers.
Part 1 out of 2
Find an expression for the perimeter of the windows.
The perimeter of the square is represented by
(x+
6 ft.

Answers

A) The dimensions are (x+10) by (x+10).

B) The perimeter is given by 4x+40.

C) The perimeter when x is 4 is 56.

The quadratic can be factored by finding factors of c, the constant, that sum to b, the coefficient of x.  Our c is 100 and our b is 20; we want factors of 100 that sum to 20.  10*10=100 and 10+10=20, so those are what we need.  This gives us (x+10)(x+10 for the factored form.  

Since the dimensions are all (x+10), and there are 4 sides, the perimeter is given by 4(x+10).  Using the distributive property we have 4*x+4*10=4x+40.

To find the perimeter when x=4, substitute 4 into our perimeter expression:

4*4+40=16+40=56.

Answer:

A) The dimensions are (x+10) by (x+10).

B) The perimeter is given by 4x+40.

C) The perimeter when x is 4 is 56.

Step-by-step explanation:

I filled two notebook papers to solve this

A department store buys 400 shirts at a cost of $7 200 and sells them at a selling
price of $20 each. Find the percent markup
The percent markup is % round to the nearest whole number as needed) .

Answers

Answer:

down below.

Step-by-step explanation:

20 × 400 = 8000

8000 - 7200 = 800

therefore the % mark up is 10%, because 10% of 8000 is 800.

800 + 7200 = 8000

Answer:

the answer is 11%

Step-by-step explanation:

hit me with praise and love this answer HAHA your welcome

ppppppppppppppppppppppppppppllllllllllllllllllllllllllllllllllllllllllllllllllllllllllzzzzzzzzzzzzzzzzzzz hheellpp

Answers

Answer:

12 because imagine 40 / 3  ok?   now what makes 160 40 x 4    so you do that for the button 4 x 3 please put heart

If my teacher has 45 hair pieces and she cuts 38 how many does she have left

Answers

Answer:

45 you have and 38 is cutted down

then 45-38 = 7 hair piece

expand and simplify (x-2)(2x+3)(x+1)

Answers

2x3 + x2 - 7x - 6 the 3 is supposed to be at the top.

5. Which of the following sets of fractions is arranged in order from LEAST to GREATEST?
O3)
○ 국
이 를

Answers

Answer:

[tex]\{\frac{1}{8},\frac{1}{4},\frac{1}{2}\}[/tex]

Step-by-step explanation:

Required

Which is ordered in ascending order

To do this, it is best to convert the fractions to decimal and then make comparison.

From the options, only (b) is ordered in ascending order and the proof is as follows.

[tex]\{\frac{1}{8},\frac{1}{4},\frac{1}{2}\}[/tex]

Convert to decimals

[tex]\{0.125, 0.25, 0.5\}[/tex]

By comparison:

[tex]0.125< 0.25< 0.5[/tex]

Hence, (b) is ordered from least to greatest

HELP PLEASE BRAINLIEST AND ITS EASY\


What is the mean of the values in the dot plot?



Enter your answer in the box.

Answers

Answer: 2

Step-by-step explanation:

2+2+1+3=8/4=2

3. ADD:
35 degrees 25 minutes 14 seconds
50 degrees 38 minutes 55 seconds

Answers

1. 924.849971 rad s
2. 2031.6719 rad s

2 1/3 x 4 4/5as a fraction

Answers

Answer:

11 1/5

Step-by-step explanation:

2 1/3 × 4 4/5

=7/3 × 24/5

=56/5

=11 1/5

exponential function models the annual rate of increase. Find the monthly and quarterly rates​

Answers

9514 1404 393

Answer:

  1.  monthly: 0.25%; quarterly: 0.75%

  2.  monthly: ≈ 0.45833%; quarterly: 1.375%

Step-by-step explanation:

In each case, the base of the exponential term is the annual growth factor. The annual growth rate (interest rate) is ...

  growth rate = growth factor - 1

Then the monthly rate is ...

  monthly rate = growth rate/12

and the quarterly rate is ...

  quarterly rate = growth rate/4

__

1. monthly rate = (1.03 -1)/12 = 0.03/12 = 0.0025 = 0.25%

  quarterly rate = (1.03 -1)/4 = 0.03/4 = 0.0075 = 0.75%

__

2. monthly rate = (1.055 -1)/12 = 0.055/12 ≈ 0.0045833 = 0.45833%

  quarterly rate = (1.055 -1)/4 = 0.055/4 = 0.01375 = 1.375%

In two or more complete sentences, describe the transformation(s) that take place on the parent function, f(x) = log(x), to achieve the graph of g(x) = log(-2x-4)-1.

Answers

Answer:

In two or more complete sentences, describe the transformation(s) that take place on the parent function, f(x)… ... parent function, f(x) = log(x), to achieve the graph of g(x) = log(-2x-4) + 1. 2 ... Re-write the transformed function by taking -2 common,. Step 1 -. Shift 2 unit left i.e, f(x)→f(x+b) shifting left by b unit.

Step-by-step explanation:

Kori has 12 strawberries, 3 pineapples, and 4 kiwis. What is the ratio of strawberries to total fruit?
HELP!

Answers

Answer:

12:19

Step-by-step explanation:

To create a ratio, we compare a portion to a whole. In this case our portion is 12 strawberries. Our whole is the total fruit, so let's add up each fruit to find the total.

12 + 3 + 4 = 19

Now we have our portion (12) and our total (19).

Let's create a ratio.

12:19

This ratio cannot be simplified further, so that is your answer.

Hope this helps!

12:19 12 is for the strawberries then if you add up all he fruit you have 19

x2 - 3|x - 2| - 4x = - 6
Solve for x

Answers

Answer:

if that is x^2 -3|x-2|-4x=-6, then this should be the answer other wise it would be a biiiit diffrent

Step-by-step explanation:

Thirty-six percent of U.S. adults have postponed medical checkups or procedures to save money. You randomly select nine U.S. adult. Find the probability that the number of U.S. adults out of the nine who have postponed medical checkups or procedures to save money is exactly 3.

Answers

Answer:

0.2693

Step-by-step explanation:

Thus is a binomial probability problem :

p = 0.36

1 - p = 0.64

n = 9

x = 3

Using the binomial probability relation :

P(x =x) = nCx * p^x * (1 - p)^(n - x)

P(x = 3) = 9C3 * 0.36^3 * 0.64^6

P(x = 3) = 84 * 0.36^3 * 0.64^6

P(x = 3) = 0.2693

Which of the following equations could be solved to determine the length of RS?

Answers

Answer:

[tex] \frac{Sin(80)}{RS} = \frac{Sin(52.5)}{7} [/tex]

Step-by-step explanation:

Given:

S = 52.5°

s = QR = 7

Q = 80°

q = RS = ?

Required:

Equation that could be used to find the length of RS

Solution:

We would need the law of Sines which is given as:

[tex] \frac{Sin(A)}{a} = \frac{Sin(B)}{b} = \frac{Sin(C)}{c} [/tex]

Applying the Law of Sines, we would have the following equation:

[tex] \frac{Sin(Q)}{q} = \frac{Sin(S)}{s} [/tex]

Plug in the values

[tex] \frac{Sin(80)}{RS} = \frac{Sin(52.5)}{7} [/tex]

Therefore, the equation that can be used to determine the length of RS is [tex] \frac{Sin(80)}{RS} = \frac{Sin(52.5)}{7} [/tex]

Simplify and write answer in standard form.

Answers

Answer:

[tex]x^3+8x^2+2x+1[/tex]

Step-by-step explanation:

Combine like terms (terms with the same exponent).

[tex]x^3+(3x^2+5x^2)+(x+x)+1=x^3+8x^2+2x+1[/tex]

"Standard form" means to list terms so the exponents go from high to low (descending order).

How many sides does an octagon have?

sides

Answers

Answer:

8 do u have a pic of it but I think it’s 8

Step-by-step explanation:

Answer:

eight

Step-by-step explanation:

3 - Triangle

4 - Quadrilateral

5 - Pentagon

6 - Hexagon

7 - Heptagon or Septagon

8 - Octagon

9 - Nonagon

Other Questions
Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable? The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)Air would not reach the bronchioles.Air would be trapped in the bronchioles.The lungs would over inflate.The lungs would lack the pressure needed to inflate. 8 yd6 yd15 yd10 ydAnswer:please help!:) After George learned that Mrs. Min suffered from schizophrenia, he mistakenly concluded that her tendencies to laugh easily and smile frequently were symptoms of her disorder. This best illustrates the: unreliability of the DSM-V unreliability of the DSM-V shortcomings of the medical model shortcomings of the medical model biasing power of diagnostic labels biasing power of diagnostic labels dangers of the biopsychosocial approach dangers of the biopsychosocial approach Which adaptations suit a beaver?