Match each mineral property to the correct description.
crystal system
the ability to attract certain metals
cleavage
the number and angle of crystal faces
magnetism
the ability of a mineral to break along flat
surfaces
fracture
an irregular way of breaking apart
fluorescence
the ability to produce a visible glow

Match Each Mineral Property To The Correct Description.crystal Systemthe Ability To Attract Certain Metalscleavagethe

Answers

Answer 1

Answer: here you go hope this helps

Explanation:

Match Each Mineral Property To The Correct Description.crystal Systemthe Ability To Attract Certain Metalscleavagethe
Answer 2

Matching each mineral property to the correct description is:

crystal system

the number and angle of crystal faces

cleavage

the ability of a mineral to break along flat surfaces  

magnetism

the ability to attract certain metals

fracture

an irregular way of breaking apart

fluorescence

the ability to produce a visible glow

A mineral property are those things that make up or characterize a mineral. For example, things like crystal forms, luster, color, etc are all ways to recognize a mineral.

Read more here:

https://brainly.com/question/6736830

Match Each Mineral Property To The Correct Description.crystal Systemthe Ability To Attract Certain Metalscleavagethe

Related Questions

PLS I need someone to upload a photo of the answer!

Answers

Answer:

See the file bellow

Explanation:

Can dependent variables be manipulated?

Answers

I believe they can..hope it’s right for you :)

Answer:

The Dependent and Independent Variables

The independent variable is the variable that is controlled and manipulated by the experimenter. ... The dependent variable is the variable that is measured by the experimenter. In our previous example, the scores on the test performance measure would be the dependent variable.                                              Hope this helps leave heart c:

How are luminosity and magnitude related?
(In your own words) ​

Answers

Answer:

Luminosity is an intrinsic(natural) measurable property of a star independent of distance. The concept of magnitude, on the other hand, incorporates distance. The apparent magnitude is a measure of the diminishing(decrease) flux of light as a result of distance according to the inverse-square law.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

The process of making proteins is called​

Answers

Answer:

translation

Explanation:

Answer:

Translation

Explanation:

At which points (A, B, C, or D) in the curve is light a limiting factor?

Answers

Answer:

D

Explanation:

What is the function of the nucleus of a cell.​

Answers

Answer:it coordinates cell activities like protein synthesis and cell division. Anatomically the nucleus is made up of several components: nuclear envelope, nuclear lamina, nucleolus, chromosomes, nucleoplasm are some of these components.

Explanation:

Answer:

The nucleus controls and regulates the activities of the cell and carries the genes, structures that contain the hereditary information. Nucleoli are small bodies often seen within the nucleus. The gel-like matrix in which the nuclear components are suspended is the nucleoplasm.

Explanation:

What causes daytime and nighttime on earth
A sun spins in space
B earth revolves around the sun
C earth spins in space
D the sun revolves around earth

Answers

Answer:C

Explanation: I am Smart

C the Earth spins in Space.

Hope this helped :)

Could there be some kind of molecular editing system ? What tools could be devised to work with genes? Could scientists then create tailored DNA molecules

Answers

yes. there already is, scientists can genetically modify plants by adding or removing genes to make them different such as make a corn stalk have 4 ears instead of 2. but also breeding like dogs and other animals is a form of molecular editing because they essentially cause a gene mutation that alters the gene sequence and created a tailored DNA molecule. like a golden doodle dog is a genetic modification of a golden retriever and a poodle it wasn’t a natural combination to begin with if you want to get into technicality’s all domesticated animals are genetically modified. BUT the plant example about GMO plants& foods is probably the best example. they can also make plant that have pesticides in their dna so they don’t have to spray them but they’re super toxic to humans and animals that eat them.

is a group of cells that have the same function.


Answers

Answer:

Tissue

Explanation:

Answer:

tissue

Explanation:

describe the six functions of membrane proteins

Answers

Answer:

All enzymes are a type of protein. As a result, a membrane protein that is embedded into the membrane can sometimes be an enzyme, which may have its active site facing substances outside of the lipid bilayer.

These types of enzymatic membrane proteins can work in teams to carry out the steps in a particular metabolic pathway, for instance breaking down lactose into carbohydrate and then monosaccharides.

Membrane proteins can allow hydrophilic molecules to pass through the cell membrane. Transport membrane proteins come in many forms, and some require energy to change shape and actively move molecules and other substances across the cell membrane. They do this by releasing ATP to use as an energy source.

Anchorage: become points of attachment for the cytoskeleton and the extracellular matrix

Some membrane proteins can feature a binding site. These binding sites are characterized by specific shapes that match the shape of a chemical messenger. For example, these chemical messengers can be hormones.

When a hormone meets with the cell wall, it will connect with a receptor membrane protein that is embedded inside the cell wall. The hormone can change the receptor protein and cause a specific reaction, depending on the type of hormone or other substance, will take place within the cell.

Another important function of membrane proteins is in identification and recognition between cells. This particular function is useful in the immune system, as it helps the body to recognize foreign cells that may be causing infection, for instance. Glycoproteins are one type of membrane protein that can carry out cell recognition.

Adjacent cells may have membrane proteins that connect in a range of different junctions. Gap junctions and tight junctions.

This function helps cells to communicate with one another, and to transfer materials between one another.

Membrane proteins are important in the cytoskeleton, the system of filaments and fibers in the cytoplasm of a cell, and the extracellular matrix (ECM), which is the network of macromolecules found outside of cells, such as collagen, enzymes, and glycoproteins, to membrane proteins.

Attaching filaments or fibers in the cytoplasm found throughout the cell can help the cell to maintain its particular shape. It also keeps the location of membrane proteins stable.

Attaching membrane proteins to the extracellular matrix can help the ECM to mediate changes that occur in extracellular and intracellular environments.

Several diseases are linked to mutations within membrane proteins. One example is a mutation called V509A, found in the thyrotropin receptor, thyrotropin being a hormone secreted by the pituitary gland that regulates the production of thyroid hormones.

This mutation increases the activity of the thyrotropin receptor and leads to congenital hyperthyroidism, a condition that can cause changes in mood, sleep problems, and stomach problems.

Other diseases that are linked to mutations in membrane proteins include hereditary deafness, Charcot-Marie-Tooth disease, which damages the peripheral nerves outside the central nervous system, and Dejerine-Sottas syndrome, that affects a person’s ability to move.

Explanation:

How do genetics (genetic predisposition) and the environment work together to cause substance abuse in individuals? What is the likely role of epigenetics in this process?

Answers

Answer: The drug abuse is influenced by the environment and exerts influence on the gene expressions.

Explanation:

The genetic make up of the person is decides, which genes will be expressed and develop a trait in an individual. But this genetic expression can be influenced by the environmental factors like food, exposure to sunlight, and others. This study which relate environment with the genetic make up is called epigenetics. No person is drug addict by birth but the consumption of drug can influence the genetic make up and traits in a abuser. So here, the environment is influencing the genetic basis of a abuser.

2 points
C-C-C-H
TL 1
H H H
---
I-U-I
I
I-U-I
I-O-I
I-O-I
I-0-1
I
1
Name the following molecule*
I-O-I
1
O=0
I-O

Answers

Can I see the picture it might help

iodine oxide? there's a lot going on i can't really tell

why are cells considered the most basic unit of life​

Answers

Answer:

Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages.

Explanation:

That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.

Hope this helps :)

Answer:  "Cells are considered the basic units of life in part because they come in discrete and easily recognizable packages. That's because all cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments.''

Explanation:

what is a non example of chloroplast?

Answers

Answer:

"Mitochondria" is the non-example of the chloroplast.

Explanation:

Hope this Helps!

Answer:

the awnser to your question is Mitochondria

Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule

Answers

Molecule dddddddddddddd
It is a molecule because you can already cross out cell and matter and atom.

Which process connects glycolysis and the citric acid cycle?

A)lactic acid formation
B)acetyl COA formation
C)electron transport
D)Krebs cycle

Answers

Answer:

b

Explanation:

because my maam said this same question in grade 7

do woody stems die off each winter and grow back the next spring

Answers

no they can survive the winter

HELP PLZ!!!

15. (01.04 LC) Which of the following best defines average speed? (3 points)

1: It is the speed of an object in a specific direction.

2: It is an object's speed at a specific point in time.

3:It is the total distance traveled over the total time.

4: It is a measure of how far an object moves in a certain time.​

Answers

Answer:

4: It is a measure of how far an object moves in a certain time.

Explanation:

Hope this helps


. the negatively charged part of an atom

Answers

Answer:

Electrons are the negatively charged particles of an atom. Together, all of the electrons of an atom create a negative charge that balances the positive charge of the protons in the atomic nucleus. Electrons are extremely small compared to all of the other parts of the atom. The mass of an electron is almost 1,000 times smaller than the mass of a proton.

Explanation:

I hope this helped!

What are the two main proceses of the carbon cycle?

Answers

Answer:

this chart will help!

Explanation:

Which is true about all unicellular and multicellular organisms?
O They are made of one cell.
O They reproduce.
They cause infections.
O They are made of multiple cells.

Answers

They both reproduce

Pea plants can have yellow seeds or green seeds Which conclusion about the meaning of Y is correct if the allele
combination Yy is for yellow seeds?
O yellow and dominant
O green and recessive
O yellow and recessive
Ogreen and dominant
Save and Exit
Next
Submit
Mark this and retum

Answers

Answer:

yellow and dominant

Explanation:

Gregor Mendel has stated that a gene comes with two alleles. According to his law of dominance, one of the alleles called DOMINANT allele is capable of masking the phenotypic expression of another allele called RECESSIVE allele.

In this question involving a seed color gene, which has two alleles Y and y. Y, which represents the dominant allele codes for the YELLOW trait while y, which represents the recessive allele codes for the GREEN trait. Therefore, a plant with Yy will have YELLOW SEEDS because the dominant allele (Y) is present.

Find the difference between testosterone and the steroid molecule.

Brainliest!

Answers

Answer:

It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.

Explanation:

does this help :)

Rollover accidents contribute to which of the following categories of agricultural workplace hazards?

respiratory risks

excessive noise

unclean conditions

vehicle hazards

Answers

Answer:

Unclean conditions

Explanation:

Answer:

Vehicle Hazards

Explanation:

Question 1 of 25
An engineer is designing a tire for heavy machinery, Which statement
describes the clearest constraint that applies to the solution?
A. It must be affordable for consumers.
B. It must be designed so that it has an appealing appearance,
C. It must cost the consumer less than $200 per tire.
D. It must function safely under a heavy load,

Answers

Answer: C. It must cost the consumer less than $200 per tire.

if someone can answer it without saying idk by november 2nd 2020 will be marked the brainliest! how does the nervous system work with the digestive system to make jump roping possible??please answer asap​

Answers

The autonomic nervous system controls the tone of the digestive tract. The brain controls drinking and feeding behavior. The brain controls muscles for eating and elimination. The digestive system sends sensory information to the brain.

Which statement describes one feature of a mineral's definite chemical composition?
It always occurs in pure form.
It always contains certain elements.
It cannot form from living or once-living materials.
It cannot contain atoms from more than one element.
ОО

Answers

Answer:

It always contains certain elements

Explanation:

Just took the test

Answer:

it always contains certain elements

Explanation:

Edge!

if you climbed up a hill,which of these statements would be true

Answers

c because yeah it’s c

Answer:

A. your weight would increase because you're farther away from Earth's center

Explanation:

honestly I'm guessing

let me know if this helps

hey can you help me with some questions​

Answers

Answer: i need this answer also

Explanation:

Other Questions
I need help with this, I'm confused about it. A cube of aluminum has a mass of 500g. What will be the mass of a cube of magnesium of the same dimensions?(Density of aluminum is 2.7g/ml) Solve the following equation for a. a-f=q A building has 40 apartments on 5 floorswhat is the unit rate? 365,000,000 scientific notation Why do Muslims fast during Ramadan? What does of mean in math master policies issued for _____ true or false: if molecules move from where there is less to where there is more , they move down the concentration gradient Answer and i will give you branilest Who supported dissenters Juan runs 6 miles in 50 minutes. At the same rate, how many miles would he run in 35 minutes? Your friend isnt as good at Spanish as you. Read how he rewrote sentences, changing the Indirect Objects to their Pronouns, and fix his errors. Some of his sentences are correct.1. l manda los paquetes a m. l manda me los paquetes. 2. Yo compro el radio para Ana y Ramn. Yo les compro el radio. 3. Ellos explican la situacin a nosotros. Ellos explican la situacin nos. 4. T compras la cena para ellos. T los compras la cena. 5. Nosotros leemos la novela a ti. Nosotros te leemos la novela. 6. Yo digo la verdad a mi madre. Yo le digo la verdad. 7. Ellos dan el telfono a ti. Ellos dan el telfono t. 8. Elena pide el pollo para Diego. Elena lo pide el pollo. 9. T traes el agua a nosotros. T nos traes el agua. 10. Marta pasa la ensalada a m. Marta pasa me la ensalada. Find the exact length of the third side. Ex 11 ) A salmon jumps vertically out of the water at an initial velocity of 6 m/s. What isthe height it will jump? OK i dont know what time it is for you so its 5:40 am but here another question.I have $40.50If i went to a store and got 3 boxes of popcorn ( $15.99)and 3 milk jugs ($12.99).Then get a pack of gum ( $1.99).Plus tax ( $4.99) add to everything.Hint plus all money then add $4.99 three times. Diego y Javier ____________ (conseguir) los vegetales para la cena.Esta maana Ud. ____________ (pedir) un caf en Starbucks.T ____________ (sentirse) muy mal ayer.La semana pasada ellos no ____________ (dormir) bien.Anoche Amparo ____________ (preferir) comer en casa.Ayer yo ____________ (vestirse) con ropa elegante.El camarero nos ____________ (servir) la cena fra a mi esposo y a m.La profesora no ____________ (repetir) las instrucciones. PLEASE HELP! I dont understand how to do it :( Which table shows a proportional relationship between x and y? Please help, thank you