Kara started a new exercise program. Kara’s sister works out with her on a regular basis and even talks to Kara about her progress. In this scenario, what is another name for Kara’s sister?
A.
goal-setter
B.
self-monitor
C.
support system
D.
nutritionist

Answers

Answer 1
A. goal setter or C. support system
Answer 2
Answers is B ,,,,,,,,,,,,

Related Questions

as the change in speed at the boundary of two materials is greater what happened to the angle of refraction (please help )
a. it becomes less
b. it becomes more
c. it stays the same

Answers

The answer is B.
Hope this helps.

About wave properties please help

Answers

Answer:

The basic properties (parts) of a wave include: frequency, amplitude, wavelength and speed. Frequency is a measure of how many waves pass a point in a certain amount of time. The higher the frequency, the closer the waves are together and the greater the energy carried by the waves will be.

Explanation:

HOPE IT HELPS U

FOLLOW MY ACCOUNT PLS PLS

When a cracker or bread dissolves in your mouth, is that a physical or chemical change?


Answers

Answer:

Chemical change.

Explanation:

The saliva or salivary amylase is a bio-catalyst...it causes chemical change during the dissolving process. Also, once the food is dissolved it can't be brought back to it's original state.

1. What is the supreme law of the United States?

Answers

Answer:

This Constitution, and the Laws of the United States which shall be made in Pursuance thereof; and all Treaties made, or which shall be made, under the Authority of the United States, shall be the supreme Law of the Land; and the Judges in every State shall be bound thereby

Hope it helps!

What is the current reading on ammeter A

Answers

Answer:

0.8A

Explanation:

The density of a material is 22.5 g/cm^3.Express this in SI units.​

Answers

Answer:

22500kg/m³

Explanation:

SI unit is kg/m³

1g/cm³=1000kg/m³

22.5g/cm³=?

22.5 * 1000

=22500kg/m³

6A. Which pair of charges has a stronger attraction, top or bottom?
6B Based on the picture above, what is the relationship between
distance between charges and force?

Answers

6A. bottom

6B. as distance between the charges increases the force weakens between them

Help pls and thank you PLEASE NO LINKS

Answers

Answer: mutation

explanation: no other species of its kind will have this mutation

Answer:

Mutation

Explanation:

Which force can either repel or attract objects?
O A. Gravitational
O B. Weak nuclear
C. Strong nuclear
D. Electromagnetic

Answers

Answer:

D. electromagnetic forces

Explanation:

Answer is D
Hope this helped :)
Brainliest plzz

Calculate the pressure at the middle of a glass jar,40cm tall and filled with Liquid A of density 9000kg/m3​

Answers

Answer:

P = 17658 Pa = 17.658 KPa

Explanation:

The pressure applied by a liquid at a given depth is given by the following formula:

[tex]P = \rho gh\\[/tex]

where,

P = Pressure = ?

ρ = density = 9000 kg/m³

g = acceleration due to gravity = 9.81 m/s²

h = depth = 40 cm/2 = 20 cm = 0.2 m

Therefore,

[tex]P = (9000\ kg/m^3)(9.81\ m/s^2)(0.2\ m)\\\\[/tex]

P = 17658 Pa = 17.658 KPa

magnet attracts nails but not copper vessels

Answers

Copper is a metal but it is not magnetic like a magnet

what do u mean by force ?​

Answers

Answer:

pushing or moving something best answer lol

Answer:

a force is any interaction that, when unopposed, will change the motion of an object.

What is the formula for calculating tension​

Answers

Answer:

In other words, Tension (Ft) = Force of gravity (Fg) = m × g. Assuming a 10 kg weight, then, the tension force is 10 kg × 9.8 m/s2 = 98 Newtons.

tension= force of gravity= m x g

Explain how a manufacturing business might participate in the ""resource disposal"" aspect of resource management.

Answers

Answer:

Resource disposal or waste disposal is a crucial aspect of resource management.

Businesses in the manufacturing sector must develop a model of operations that allows an endless loop of internal recycling of waste and or processing waste resources into commercial resources.

A good example would be when an abattoir processes the internal organs of cows and goats with some waste gotten from rice mill into can food for dogs and canines. Waste from this secondary process can either be converted into organic manure to be sold to farmers or processed further for consumption at carnivorous fish farms.

Cheers

Which of the following electrical components protects your home from excessive flow of current in the electrical wires?

- resistor
- fuse
- transistor
- capacitor​

Answers

Answer: the correct option is FUSE.

Explanation:

Current Electricity consists of fast moving negatively charged electrons which travels in materials that allows the flow of electrons called conductors. In the generation of Electricity for distribution, two types of currents are being generated. It's either an Alternating current ( A.C) or a Direct Current ( D.C.). An A.C. consists of electric charges that constantly changes its position and direction of flow of voltage and current while D.C. the electric charge flow in one direction. For the safety of devices of the end users of the electric current ( either A.C. or D.C) generated, a FUSE is usually used to protect the appliances from too much flow of electric current.

A fuse is therefore defined as a safety device that protects appliances( such as televisions, refrigerators, computers) from current overload or voltage fluctuations which can cause damaging effects. It is made up of thin strip or strand of metallic wire with noncombustible material. These devices are usually connected in series with the components to be protected from current overload. This is so because, when there is high or excessive current, the fuse melts and it opens the circuit and disconnects it from the power supply. Some of the types of fuse includes A.C fuse and D.C. fuse.

One of the ways that scientists determine the distance between Earth and other objects in space is to send light waves toward an object and measure how long it takes for the waves to bounce back. If a scientist sends light waves to four different objects in space, which of the following will take the longest to bounce the wave back to Earth?


a star in the Milky Way Galaxy


a star in the Andromeda Galaxy


a planet in Earth's Solar System


a planet in another star system within the Milky Way Galaxy

Answers

Answer:

a star in andromeda

Explanation:

all of the other objects are in the milkyway (where we are) and the andromeda galaxy is 2 million light years away from us

An astronaut drops a 1.0 kg object and a 5.0 kg object on the Moon. Both objects fall a total distance of 2.0 m vertically. Which of the following bost describes the objects after they have fallen a distance of 1.0 m2
They have each gained one-half of their maximum kinetic energy
They have cach lost the same amount of potential energy
They have each gained the same amount of potential energy
They have each lost kinetic energy

Answers

Answer:

Chupapi munyaño hoyaaaa

How can you cause a substance to turn from a solid to a liquid or from a liquid to a gas? Help

Answers

Answer:

When the temperature increases

Explanation:

Imangine a car moving down a street. From which reference point would the street appear to be moving?

A: From the sky
B:From the street
C:From the car
D: From the sidewalk

Answers

From the sky. It actually depends on where YOU are, but hey, since the earth is round (dam you flat earthers) you would see the street as if it was flying and the car is pulling it back to the ground as you approach the car. Alright, that’s it. Can I have brainliest? :)

What is the name of the process where rocks are being broken down into small grains of sediment or soil?
A) Weathering
B) Erosion
C) Deposition
D) Uplifting

Answers

Answer:

a. weathering

Explanation:

weathering is the breakdown of rocks into sediments and soil

Approximately how much electrical energy does a 5-W lightbulb convert to radiant and thermal energy in one hour?​

Answers

Answer:

18,000 j

Explanation:

the lightbulb dissipates 5W of power

P = ΔE / Δt

rearrange to solve for energy

ΔE = PΔt

P = 5W

t =  1 hour = 60 minutes = 3600 seconds

ΔE = 5 * 3600

ΔE = 18000 J

the process of mitosis makes body cells which are also called_______ cells.
NEED DONE ASAP!!!!!

Answers

Answer:

daughters cells

Explanation:

when people refer to “cell division,” they mean mitosis, the process of making new body cells. Meiosis is the type of cell division that creates egg and sperm cells. Mitosis is a type of cell division in which one cell (the mother) divides to produce two new cells (the daughters) that are genetically identical to itself.

yes that person is right. well for me at least. please like

A 0.547 kg pizza is thrown straight up in the air. At a height of 2.30 m above the surface of the earth it has a speed of 5.00 m/s. Calculate the total mechanical energy of the pizza crust.

Answers

Answer:

The total mechanical energy of the pizza crust is 19.2 J.

Explanation:

Mechanical energy is that which a body or a system obtains as a result of the speed of its movement or its specific position, and which is capable of producing mechanical work. Then:

Potential energy + kinetic energy = total mechanical energy

Kinetic energy is a form of energy. It is defined as the energy associated with bodies that are in motion and this energy depends on the mass and speed of the body.

Kinetic energy is defined as the amount of work necessary to accelerate a body of a certain mass and in a position of rest, until it reaches a certain speed.

Kinetic energy is represented by the following formula:

Ec = ½ *m*v²

Where Ec is kinetic energy, which is measured in Joules (J), m is mass measured in kilograms (kg), and v is velocity measured in meters over seconds (m / s).

In this case:

m=0.547 kgv= 5 m/s

Replacing:

Ec = ½ *0.547 kg*(5 m/s)²

and solving you get:

Ec= 6.8375 J

On the other hand, potential energy is the energy that measures the ability of a system to perform work based on its position. In other words, this is the energy that a body has at a certain height above the ground.

Gravitational potential energy is the energy associated with the gravitational force. This will depend on the relative height of an object to some reference point, the mass, and the force of gravity. Then for an object with mass m, at height h, the expression applied to the gravitational energy of the object is:

Ep = m*g*h

Where Ep is the potential energy in joules (J), m is the mass in kilograms (kg) is h the height in meters (m) and g is the acceleration of fall in m / s² (approximately 9.81 m/s²)

In this case:

m= 0.547 kgg= 9.81 m/s²h= 2.30 m

Replacing

Ep= 0.547 kg *9.81 m/s²* 2.30 m

and solving you get:

Ep= 12.342 J

So:

Total mechanical energy= 12.342 J + 6.8375 J

Total mechanical energy= 19.1795 J≅ 19.2 J

The total mechanical energy of the pizza crust is 19.2 J.

What causes tides to occur?

The gravitational attraction between the Sun, Earth, and Moon.

The magnetic pull of the Earth's poles

The shaking of the earth during earthquakes

Seafloor spreading

Answers

Answer:

The gravitational attraction between the sun earth and moon

a horizontal force of 25 newtons eastward causes a 10 kg box to have a displacement of 5m eastward. The total work done by the 25 Newton force is?​

Answers

Answer:

125 J

Explanation:

Work done = force * distance

work = 25 * 5

work = 125 J

125 J hope it helps

Rama's weight is 4okg: She is carrying a load of 20kg up to a height of 20 meters.what work does she do?Also mention its type of work​

Answers

Answer:

rama is doing

Explanation:

work done=f×d×g

=60×20×9.8

=11760j

she is doing work against gravity

mark me

body composition is?

Answers

Answer: body composition is the proportion of fat and non fat mass in your body.

Explanation:

Answer:

Body composition is the percentage of a body's weight

Explanation:

Body composition is the body's amount of fat relative to fat-free mass. Individuals with optimal body composition are typically healthier, move more easily and efficiently, and generally feel better.

if mechanical advantage and velocity ratio of a machine are equal then the simple machine is called what​

Answers

Answer:

hbyjhtcgfcyh

Explanation:

Can someone please help me with science.

Answers

Answer:

I think it is D or A

Explanation:

I have not done this in a long time, so sorry if wrong.

help me plsss! no links

Answers

Answer:

a is the answer to the question

Other Questions
PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable? The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)Air would not reach the bronchioles.Air would be trapped in the bronchioles.The lungs would over inflate.The lungs would lack the pressure needed to inflate. 8 yd6 yd15 yd10 ydAnswer:please help!:)