A legal theory in South African law known as the nasciturus fiction, that recognizes the fetus as a legal subject for particular purposes. It is based on the notion that a fetus in utero is assumed to have been born for all purposes provided that it is subsequently born alive and advantageous to it.
As opposed to being a rule of law, the nasciturus fiction is a legal presumption that can be disproved by evidence. Exparte Bodel Steenkamp, a case where the unborn child had a right to inherit from its mother's estate, is one instance where this is acknowledged in South African case law.
The nasciturus fiction is also acknowledged in South African legal statutes, such as the Intestate Succession Act, which states that a child born alive after the death of an intestate person who was conceived before their death is entitled to inherit from their estate. An example of how the nasciturus fiction has been used in South African law is the case of Exparte Bodel Steenkamp 1962 (3) SA 954 (O).
Learn more about Succession Act at:
brainly.com/question/12408045
#SPJ4
Explain how the New York State Pension System Work
Your pension is determined by your years of credited service, retirement age, and final average salary (FAS).
FAS is the average of your earnings throughout the last 36 months of service when you earned the most. Typically, this is the last three years of employment.
The New York State Common Retirement Fund is a public pension plan for New York State government employees. It is the third largest public pension plan in the country, with $207.4 billion in assets as of 2018.
The New York State Comptroller's office oversees these assets, which are held on behalf of nearly one million members of the New York State and Local Retirement Systems (NYSLRS). Its one-year return was 11.35% as of March 31, 2018, however its 10-year return was 6.4%.
To know more about pension:
https://brainly.com/question/31215595
#SPJ1
What was the supreme court’s ruling in new york times co. V. Sullivan?.
The Supreme Court's ruling in New York Times Co. v. Sullivan was that public figures must prove actual malice in order to establish a claim for defamation.
In other words, the Supreme Court decided that for a public figure to win a defamation case against a news organization, they must demonstrate that the news organization acted with actual malice, meaning they knew the information was false or acted with reckless disregard for the truth.
This decision established a higher standard of proof for public figures in defamation cases, in order to protect the First Amendment rights of the press. New York Times Co. v. Sullivan was a landmark case in the field of American defamation law. It arose out of an advertisement that the New York Times published in 1960, which solicited funds for the civil rights movement in the southern United States.
To know more about Supreme Court, click here.
https://brainly.com/question/12848156
#SPJ4
discuss the purpose of aggravating factors in a disciplinary hearing
Aggravating factors are used in a disciplinary hearing to provide a clearer understanding of the severity of the offence committed by the accused. They are used to highlight any factors that may have contributed to the offence being committed or any actions taken by the accused that may have worsened the impact of the offence. The purpose of aggravating factors is to ensure that the disciplinary action taken is appropriate and proportionate to the offence committed, ensure that justice is served and promote a healthy and productive work environment.
The purpose of aggravating factors in a disciplinary hearing is to:
1. Highlight the seriousness of the offence: Aggravating factors emphasize the severity of the misconduct and help the decision-maker understand the potential impact it has on the organization or individuals involved.
2. Determine the appropriate disciplinary action: By considering aggravating factors, decision-makers can ensure that the disciplinary action taken is proportionate to the offence committed and the circumstances surrounding it.
3. Ensure consistency in disciplinary procedures: Aggravating factors help maintain fairness and consistency by providing a framework for considering and evaluating the severity of different offences in disciplinary hearings.
4. Discourage repeat offences: The inclusion of aggravating factors in disciplinary hearings serves as a deterrent to potential repeat offenders, as they are made aware of the serious consequences that may result from their actions.
In summary, aggravating factors in a disciplinary hearing serve to highlight the seriousness of the offence, determine appropriate disciplinary action, ensure consistency in disciplinary procedures, and discourage repeat offences.
Learn more about the person accused of a crime: https://brainly.com/question/31229571.
#SPJ11
How do the characteristics listed those on parole play into our own cultural and racial biases ? What can be done to help counteract such a stereotype? I need help with this question
The characteristics that are typically associated with individuals on parole, such as a criminal history, low socioeconomic status, and minority status, can often lead to cultural and racial biases that unfairly impact these individuals.
These biases can lead to discrimination and prejudice, which can negatively affect the ability of individuals on parole to reintegrate into society and obtain employment, housing, and other essential resources.
To counteract these stereotypes, it is important to raise awareness about the negative effects of cultural and racial biases and to promote education and training that emphasizes the importance of treating all individuals with respect and dignity. This can be achieved through various means, including:
Education and awareness campaigns - these can be designed to raise awareness about the negative effects of cultural and racial biases and to promote understanding and acceptance of diversity.
To learn more about stereotype here
https://brainly.com/question/361502
#SPJ4
Who was the most influential British criminologist in all of criminology?
A. Charles Goring
B. Roger Matthews
C. Stuart Hall
D. Mary MacIntosh
Roger Matthews was the most influential British criminologist in all of criminology
Who was the most influential British criminologist in all of criminology?Criminology has been a substantial and wide-ranging academic field that compresses abundant hypothetical outlooks and examination regions. To decide on the mainly influential British criminologist is not simple as numerous erudites have produced momentous additions to this domain.
Jock Young, for example, was an early investigator in the area of cultural criminology and also one of the first scholars to investigate the effect of global integration on criminality.
Read more on criminology here:https://brainly.com/question/14317864
#SPJ1
Online contracts: carlos sees offer for 2 free tickets to basketball game online. he quickly hits the 'i accept' button. after reading the fine print, he realizes that by accepting the offer, he signed up for a 1 year subscription, which he must pay for upon receipt. is carlos bound by the agreement?
(yes) or (no)
Yes, Carlos is bound by the agreement by hitting the 'I accept' button he entered in a legally binding contract.
A legally binding agreement is a pact between two or more parties in which they make a commitment to do or refrain from doing something. It may be expressed verbally, in writing or inferred from the actions of the parties. A valid agreement must contain a number of essential components, including an offer, acceptance, consideration, the parties legal capacity, and a legitimate purpose.
Even if he did not read the fine print by clicking the "I accept" button he entered into a legally binding contract with the company selling the tickets. Before accepting an online offer, it is typically taken for granted that the person has read and comprehended the terms and conditions.
It is crucial to thoroughly read and comprehend any agreement before agreeing to its terms whether online or in person.
Learn more about binding contract at:
brainly.com/question/30750666
#SPJ4
What branch of government do regulatory agencies fall under?.
Discuss the notion of Ubuntu with reference to transformative constitutionalism,case law,and jurisprudence in your answer.
Ubuntu is a phrase that comes from the Bantu languages of southern Africa and is frequently translated as "humanity towards others." It is a philosophical idea that places a strong emphasis on the connectivity of all people as well as the value of kindness, empathy, and community.
Ubuntu has become a key value and principle in the creation of a new constitutional order that is based on social justice, human dignity, and the advancement of the common good in the context of transformative constitutionalism.
Ubuntu has been acknowledged as a fundamental value in South African legal doctrine for interpreting and applying the Constitution. The Constitutional Court ruled in the historic case of S v. Makwanyane that the death penalty was unconstitutional since it contravened the ideal of Ubuntu,
To know more about constitutionalism visit :
https://brainly.com/question/4278982
#SPJ4
Suppose that, under a new city ordinance, police officers would have a choice when it comes to dealing with persons possessing less than four ounces of marijuana. relying on their discretion, officers could (a) arrest the offender, leading to possible jail time; or (b) write the offender a ticket, treating the infraction like a traffic violation. would this be a just and fair policy? would it make it easier or more difficult for police officers to protect the community? why or why not?
Under the proposed city ordinance, police officers would have discretion when dealing with individuals possessing less than four ounces of marijuana. They could either (a) arrest the offender, leading to possible jail time or (b) write the offender a ticket, treating the infraction like a traffic violation.
Whether this policy is just and fair depends on various factors, such as the potential for unequal treatment, the prioritization of law enforcement resources, and the impacts on the community. On one hand, allowing officer discretion could lead to inconsistencies and potential biases in how offenders are treated. On the other hand, treating minor marijuana possession as a traffic violation could reduce the burden on the criminal justice system and allow officers to focus on more serious crimes.
As for the impact on police officers protecting the community, this policy could make it easier for them to allocate resources more effectively and concentrate on higher-priority issues. However, if discretion is not applied consistently and fairly, it could create mistrust and tensions within the community. Ultimately, the success of this policy would depend on how effectively it is implemented and monitored.
To know more about the Illegality of Marijuana Possession- https://brainly.com/question/29800924
#SPJ11
4. using some of the insights from environmental criminology, do you think your neighborhood is likely to have high or low rates of crime? why? give specific examples in your answer.
Environmental criminology suggests that crime is not solely the result of individual characteristics, but is also influenced by environmental factors. These factors can include physical features of the environment, such as the layout of streets and buildings, as well as social and economic conditions, such as poverty and inequality.
Based on these factors, a neighborhood with high levels of crime might have characteristics such as:
Poorly maintained or abandoned buildings and public spaces, which may attract criminal activity.
High levels of poverty and unemployment, which can lead to desperation and criminal behavior.
A lack of social cohesion or community involvement, which can make it easier for criminals to operate without fear of detection.
A history of crime and violence, which can lead to a "culture of crime" in the area.
On the other hand, a neighborhood with low levels of crime might have characteristics such as:
Well-maintained public spaces and buildings, which can discourage criminal activity.
A strong sense of community and social cohesion, which can make it more difficult for criminals to operate unnoticed.
Good social and economic conditions, such as low levels of poverty and unemployment, which can reduce the likelihood of criminal behavior.
Good infrastructure and access to services, such as education and healthcare, which can improve overall quality of life and reduce desperation that can lead to crime
To learn more about criminology here
https://brainly.com/question/28996894
#SPJ4
Identify the functions of court systems related to sancturary cities in the resources provided?
senate bill 4 was all that was provided.
Senate Bill 4 (SB4) is a state-wide law in Texas that is designed to bar sanctuary cities from existing.
This law seeks to do this by requiring local law enforcement officials to cooperate with federal immigration enforcement efforts and to allow the federal government to enforce immigration laws in local jurisdictions. It also requires local officials to act on behalf of federal immigration agents when asked.
This law is intended to deter illegal immigration and punish local governments that choose to ignore federal immigration laws. By including stiff penalties for noncompliance and by allowing the state to pursue legal action against local officials who fail to comply, SB4 is intended to serve as a deterrent to sanctuary city policies. In addition, SB4 also provides a mechanism for the state to monitor and enforce compliance with the law. This includes the ability to take legal action against sanctuary cities if they fail to comply.
To know more about Senate Bill , click here:
https://brainly.com/question/11494587
#SPJ4
Which of these is considered the heart of the complaint ? a. the request for relief b. the statement of claim c. the court jurisdiction and the name of parties involved d. detailed information on the plaintiff and the defendant
The heart of the complaint is generally considered to be the request for relief, which outlines what the plaintiff is seeking from the court. Therefore, Option A) is correct.
The request for relief is typically the most important part of the complaint because it sets out the specific remedy or remedies that the plaintiff is seeking.
The statement of claim provides the background information and details of the dispute, while the court jurisdiction and the name of the parties involved simply identify the court and the parties to the action.
Detailed information on the plaintiff and defendant may be important for establishing jurisdiction or for other procedural matters, but it is not typically the most significant aspect of the complaint.
In summary, the request for relief is the key element of the complaint as it identifies what the plaintiff hopes to achieve through the legal process.
To learn more about the plaintiff, visit: https://brainly.com/question/28425238
#SPJ11
Tricia found a body that is in rigor mortis. How was she MOST likely to determine that this was happening?
Answer:
Explanation:
Rigor mortis is the stiffening of the body's muscles that occurs after death, due to a chemical change in the muscle tissue. The onset and progression of rigour mortis can provide valuable information about the time of death and can be used to help determine the cause of death.
Tricia is most likely to determine that the body is in rigour mortis by observing the stiffness and rigidity of the body's muscles. During rigour mortis, the body becomes stiff and immobile, and the muscles are difficult to move or manipulate. This stiffness typically begins within a few hours after death and reaches its peak after approximately 12-24 hours, before gradually diminishing over the next 24-48 hours.
Tricia could also confirm rigour mortis by attempting to move the body's joints or limbs. During rigour mortis, the joints become fixed and difficult to move, and the limbs may be difficult to flex or extend. Additionally, Tricia may observe other signs of death, such as livor mortis (a purplish-red discolouration of the skin due to blood settling) and algor mortis (the cooling of the body temperature after death).
PLS MARK ME BRAINLIEST
Tricia most likely determined that the body was in rigor mortis by observing the stiffening of the muscles and joints. Rigor mortis is a postmortem process where the body becomes stiff due to the depletion of ATP, which is necessary for muscle relaxation. This stiffness usually starts within 2-4 hours after death and reaches maximum stiffness in about 12 hours. Therefore, if Tricia observed a stiff and immobile body, it would be a strong indication that the body was in rigor mortis.
To determine rigor mortis, Tricia would have:
1. Checked for stiffness: She would have noticed that the body's muscles were stiff and difficult to move, indicating that rigor mortis had set in.
2. Assessed the body's temperature: Rigor mortis typically starts a few hours after death, and the body would be cold to touch at this stage.
3. Looked for other post-mortem signs: To be certain of rigor mortis, Tricia might also have checked for other post-mortem changes such as livor mortis (discolouration of the skin) or algor mortis (body temperature decrease).
By observing these signs, Tricia was most likely able to determine that the body was in rigor mortis.
Learn more about rigor mortis: https://brainly.com/question/13554527.
#SPJ11
Susan works at the local grocery store stocking shelves. She wants to learn how to operate the cash register and work as a cashier, but she does not know how to talk to her boss about it. You are not sure if this is a good idea because you know that the cashier shifts are longer and less flexible. You do not think the schedule change would work well for Susan. Which of the following actions would MOST support self-advocacy?
The actions would MOST support self-advocacy is You explain to Susan that the cashier schedule would be too hard for her. You ask her not to talk to her boss about a change.
What is self advocacySelf-advocacy stands for the act of supporting oneself and defending one's own interests, necessities, and entitlements. To this end, individuals proactively express themselves verbally, make determinations and take actions solely on their behalf so as to enhance the quality of their existence and accomplish objectives they have set out to achieve.
For those persons confronted with disabilities, such personal representation acquires even more significance, because they run up against considerable challenges in securing services, support networks or exercising their individual rights when compared to other members within a community.
Read more on self advocacy here:https://brainly.com/question/10346595
#SPJ1
complete question
Susan works at the local grocery store stocking shelves. She wants to learn how to operate the cash register and work as a cashier, but she does not know how to talk to her boss about it. You are not sure if this is a good idea because you know that the cashier shifts are longer and less flexible. You do not think the schedule change would work well for Susan. Which of the following actions would MOST support self-advocacy?
a) You arrange a meeting with Susan and her employer so you can talk about the accommodations Susan would need to fill the cashier role.
b) You help Susan plan out the steps of asking her boss for a meeting. You also help her type notes about what she wants to say in the meeting.
c) You tell Susan you are excited to hear that she is pursuing her goals, and ask her to let you know the outcome of her discussion with her boss.
d) You explain to Susan that the cashier schedule would be too hard for her. You ask her not to talk to her boss about a change.
how to get guardianship of a child without going to court
a mother executes a deed stating that upon her death the property will convey to her son, abraham lacey. the mother created which type of estate?
A mother signs a deed stating that her son, Abraham Lacey, will inherit the property upon her death. A specific kind of life estate was created by the mother. The correct answer is (D).
If a woman's mother acquires a property through her will, gift, inheritance, or self-acquired property, she becomes the sole owner. The Hindu Succession Act of 1956 (the Act) governs how a mother's property is divided according to Hindu law. Intestacy succession is covered by the Act.
The mother cannot dispose of the ancestral property she received in accordance with her will. Therefore, you may challenge and request a portion of that. If the gift deed was signed under questionable circumstances, you can challenge it. Otherwise, the mother can sign a registered gift deed to transfer her assets to anyone.
To learn more about life estate here
https://brainly.com/question/30761355
#SPJ4
Q- A mother executes a deed stating that upon her death the property conveys to her son, Abraham Lacey. The mother created which type of estate?
a) Estate in revision
b) Estate for years
c) Nonfreehold estate
d) a Life estate
What is the STR found within the DNA sequence? TCATGCGATGATGATGATGATCGCT
A. CAT
B. GCG
C. ACG
D. GAT
The STR (short tandem repeat) found within the DNA sequence is "GAT", which is repeated five times in a row. The correct option is D.
In the given DNA sequence "TCATGCGATGATGATGATGATCGCT" The term "STR" stands for "Short Tandem Repeat" which is a nucleotide sequence that repeats. A section of DNA known as an STR is made up of a few nucleotides that are repeated in tandem. The repeated sequence in the given sequence "GAT" appears five times in a row. In forensic science repeating sequences are frequently used to identify people.
It is a particular area of DNA where a short nucleotide sequence repeats several times in a row. Individuals can differ in the number of repeats, which is used as a distinctive genetic marker for identification. The analysis of STRs is used in DNA profiling and genetic fingerprinting to ascertain an individual's genetic make up. The correct option is D.
Learn more about Short Tandem Repeat at:
brainly.com/question/29661522
#SPJ4
does chase freedom unlimited have foreign transaction fees?
Answer:
Explanation:
No, Chase Freedom Unlimited does not have foreign transaction fees. This means that you can use your card for purchases outside the United States without incurring any additional fees. However, keep in mind that foreign merchants may charge a fee for using a credit card, which is separate from any fees charged by the card issuer. It is always a good idea to check with the merchant and your credit card issuer about any fees before making a purchase.
PLS MARK ME BRAINLIEST
Distinguish between the eurocentic and africa approaches to corrections and punishment
The Eurocentric approach to corrections and punishment focuses on retribution, deterrence, incapacitation, and rehabilitation, while the African approach emphasizes restorative justice, community involvement, reconciliation, and collective responsibility.
The Eurocentric approach to corrections and punishment typically focuses on the following aspects:
1. Retribution: Punishment is aimed at making the offender pay for their crime.
2. Deterrence: Punishment serves as a deterrent to prevent future criminal behaviour.
3. Incapacitation: Offenders are removed from society to protect the public.
4. Rehabilitation: Programs are provided to help offenders change their behaviour and reintegrate into society.
On the other hand, the African approach to corrections and punishment is based on the following principles:
1. Restorative justice: The focus is on repairing the harm caused by the crime and promoting healing for the victim, the offender, and the community.
2. Community involvement: The community plays an active role in the offender's rehabilitation and reintegration process.
3. Reconciliation: The aim is to restore relationships and promote social harmony.
4. Collective responsibility: The responsibility for addressing crime and punishment is shared among individuals, families, and the community.
Learn more about the Eurocentric approach to corrections and punishment: https://brainly.com/question/27175976.
#SPJ11
Who does Chief Justice Rehnquist say should be responsible for addressing the social problems of our
country?
Answer:
Through the popularly elected branches (not the unelected judiciary).
On Halloween night, John and several of his friends decided to pull some pranks at their high school and damaged some of the classrooms. The next morning, school security officers reviewed the security videotapes to see who had done the damage. What will the students be charged with?
Answer:
The students may be charged with vandalism or malicious mischief, which involves damaging or defacing property without the owner's consent. Depending on the severity of the damage, the charges could be a misdemeanor or a felony. In addition to criminal charges, the students could also face disciplinary action from their school, including suspension or expulsion. It is important to note that vandalism is a serious crime and can have long-lasting consequences for the individuals involved.
Explanation:
1. civil law may handle a court case involving ( point ) obattery. oassault . first - degree murder . onegligence . 2 . a defendant may be on trial in a criminal law court room if he or she is accused of ( 1 point ) onegligence . odrafting a faulty contract . orape . oneglecting alimony payments .
Civil law may handle a court case involving negligence, battery, assault, and first-degree murder.
These are a few illustrations of civil wrongs, also known as torts, which cause harm or injury to another person or their property. If a defendant is charged with assault, the case may be heard in a criminal law court. Non-consensual contact is a serious criminal offense that is typically prosecuted in criminal court.
Falsely drafting a contract or failing to make alimony payments are not crimes and are typically dealt with in civil court or through an alternative dispute resolution process like mediation or arbitration.
Learn more about Civil law at:
brainly.com/question/14788507
#SPJ4
Explain with example that no job is inferior to any other
To demonstrate that no job is inferior to any other, let's consider two different jobs: a doctor and a janitor. Each job contributes to society in its own unique way, and all are essential for maintaining the well-being of our communities.
A doctor is responsible for diagnosing illnesses, prescribing medications, and providing medical care to patients. Their job is crucial to maintaining the health and well-being of society. On the other hand, a janitor is responsible for maintaining cleanliness, sanitation, and safety in public places like hospitals, schools, and offices.
While some may argue that a doctor's job is superior due to their extensive education and the critical nature of their role, it's essential to recognize the importance of a janitor's work as well. Without janitors, public places would become unsanitary, leading to the spread of diseases and a decline in overall public health. In this sense, the janitor's role is just as vital to maintaining a healthy society as the doctor's role.
Learn more about no job is inferior to any other: https://brainly.com/question/18831347.
#SPJ11
4 factors that determine what committee a member of congress joins
Answer:
Explanation:
There are several factors that can influence which committee a member of Congress joins, including:
The member's personal interests and expertise: Members of Congress may join committees that align with their personal interests or areas of expertise, allowing them to have a greater impact on issues that they care about.
The member's constituency: Members of Congress may also join committees that are particularly relevant to the needs and interests of their constituents. For example, a member representing a district with a significant agricultural sector may join the Agriculture Committee.
The member's seniority: Seniority is often an important factor in committee assignments, particularly in the House of Representatives. Members who have been in Congress longer may have greater opportunities to join high-profile committees.
The needs of the party leadership: The party leadership may also play a role in committee assignments, particularly for members who are seen as potential leaders within the party. Party leaders may try to place members on committees that align with the party's priorities and where they can have the greatest impact on policy.
PLS MARK ME BRAINLIEST
The four factors that determine what committee a member of Congress joins are party affiliation, seniority, personal interests, and constituent needs.
Party affiliation is often the most important factor, as committee assignments are usually controlled by the majority party in each chamber. Seniority is also a significant factor, as more experienced members often receive priority in committee assignments. Personal interests can also play a role, as members may seek out committees that align with their expertise or policy goals.
Finally, constituent needs may influence committee assignments, as members may prioritize committees that address issues important to their constituents. Overall, committee assignments are a key way that members of Congress can shape policy and influence the legislative process.
Learn more about Congress: https://brainly.com/question/779570
#SPJ11
criminal justice is a system of procedures and processes to protect people, bulldings and property, and
information?
Yes, criminal justice is a system of procedures and processes that are designed to protect people, buildings, property, and information from criminal activity.
The criminal justice system includes law enforcement agencies, the courts, and correctional facilities. The primary goal of the criminal justice system is to prevent crime by deterring potential offenders and by punishing those who do commit crimes.
To achieve this goal, the criminal justice system relies on a range of tactics, including investigation and surveillance, prosecution and trial, sentencing, and incarceration. The system also aims to provide support and services to victims of crime and to promote rehabilitation and reintegration for offenders.
The criminal justice system is complex and constantly evolving, and it plays a critical role in maintaining the safety and security of communities.
To know more about criminal justice visit:
https://brainly.com/question/30629034
#SPJ11
What can be derived from a firearm and its projectiles?
Firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.
What informs firearms and their projectiles?Firearms and their projectiles can provide a wealth of information to investigators and forensic experts in criminal investigations, as well as to engineers and researchers studying the performance and characteristics of firearms.
From a firearm, one can determine its make, model, and caliber. The firearm's serial number can also be used to trace its ownership and history. The condition of the firearm can provide information about its maintenance and use.
From the projectile, one can determine the caliber, type of bullet, and the angle of impact. The projectile's trajectory can be used to determine the location of the shooter and the direction of the shot.
Forensic experts can also analyze the gunshot residue left on the firearm and the shooter's hands to determine if the person fired the weapon. The presence of fingerprints or DNA on the firearm can also be used to identify the shooter.
Overall, firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.
learn more about Firearms and their projectiles: https://brainly.com/question/30244650
#SPJ1
What is methodology in research paper
please answer
Which of the following psychological factors impact the reliability of eyewitness testimony?
Anxiety
Eyesight
Perception
Sensory overload
Analysis of legal signs of genocide. distinguish between genocide and crimes against humanity
The legal signs of genocide, as defined by the United Nations Genocide Convention, include the intentional and systematic destruction of a national, ethnic, racial, or religious group. This can manifest in a variety of ways, including killing members of the group, causing serious bodily or mental harm to members of the group, imposing measures intended to prevent births within the group, and forcibly transferring children of the group to another group.
Crimes against humanity, on the other hand, refer to a broader category of atrocities committed against a civilian population. This can include acts such as murder, enslavement, torture, sexual violence, and forced displacement. Unlike genocide, crimes against humanity do not require an intent to destroy a specific group but rather are defined by the widespread and systematic nature of the attacks.
In summary, while both genocide and crimes against humanity involve serious violations of human rights and international law, genocide is distinguished by its specific targeting of a particular group for destruction, whereas crimes against humanity are defined by their widespread and systematic nature.
To know more about What is genocide- https://brainly.com/question/23582099
#SPJ11
The legal signs of genocide involve intentionally and systematically destroying a particular racial, ethnic, religious, or national group. According to the United Nations Genocide Convention, genocide includes acts such as killing, causing serious bodily or mental harm, inflicting conditions designed to bring about the group's physical destruction, imposing measures to prevent births, and forcibly transferring children to another group.
Crimes against humanity, on the other hand, encompass a broader range of acts committed as part of a widespread or systematic attack against a civilian population. These acts include murder, extermination, enslavement, deportation, imprisonment, torture, sexual violence, persecution, enforced disappearances, and other inhumane acts. While genocide targets explicitly a particular group intending to destroy it, crimes against humanity can be committed against any civilian population without the requirement of a specific intent to annihilate a particular group.
To distinguish between genocide and crimes against humanity, consider the following steps:
1. Identify the acts committed and the targeted population.
2. Determine if there is a specific intent to destroy a particular group (genocide) or if the acts are part of a widespread or systematic attack against a civilian population (crimes against humanity).
3. Analyze the legal signs of genocide, such as the systematic nature of the acts and the specific methods used to destroy the group.
4. Compare the acts and intentions to the definitions of genocide and crimes against humanity under international law.
In conclusion, the main difference between genocide and crimes against humanity lies in the specific intent to destroy a particular group in the case of genocide. In contrast, crimes against humanity involve a broader range of acts against any civilian population. By analyzing the legal signs and the intentions behind the actions, it is possible to distinguish between these two grave international crimes.
To learn more about genocide, visit: https://brainly.com/question/4266491
#SPJ11
What are some financial stressors in your life?