Is this correct? I really need to know this

Answers

Answer 1

Yes it is! To find slope you need to find the rise over run, which you can see it rises up 2 times and over once, so 2/1 which is equal to 2 :)

Answer 2

Answer:

Slope (m) = 2

Step-by-step explanation:

[tex]m=\frac{y_2-y_1}{x_2-x_1}[/tex]

consider 2 points - (20,20) and (30,40)

[tex]m = \frac{40-20}{30-20}[/tex]

[tex]m=\frac{20}{10}[/tex]

[tex]m=2\\[/tex]

∴ Slope (m) = 2

Related Questions

Question is down in the image

Answers

Answer:

It is (33.3) [Last one]

Step-by-step explanation:

I hope that is useful for you :)

This equation is basically 35.6 -2.3, you just reverse the numbers

35.6

- 2.3

33.3

The answer is D

what is the area of the figure at the right 14cm 16cm 20cm 38cm

Answers

Answer:

170240

Step-by-step explanation:

Your answer for the question is 170240

what is 26 x4 hurry ii need it nowwwww

Answers

104

6 x 4 = 24
20 x 4 = 80

80 + 24 = 104.

BOOM MAGIC

the answer is 104 hope it helps

A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot.

Answers

Answer:

22.4

Step-by-step explanation:

delta math

Answer:22.4

Step-by-step explanation:

Is 16/36 the same value of 4/9?

Answers

Answer:

Yes, 16/36 and 4/9 are equivalent fractions; the latter is the simplified form of the original fraction: 16/36.

Step-by-step explanation:

Given X=[b a 4 a], Y=[c d a b], and Z=[a c 16 b]. What is Y if x-2y=z?

Answers

Answer:

[2, -4, -6, -2]

Step-by-step explanation:

If f(x) = 3x + 2 and g(x) = -x^2 + 1, which is f(g(x))?

Answers

Answer:

-3x^2+5

Step-by-step explanation:

f(g(x)) = 3(g(x))+2 = 3(-x^2)+3+2 = -3x^2 +5

Determine the coordinates of the point shown. 5 4 3 2- 0 -5 4 -3 -2 -1 0 2. 3 4 5 -2- -3 O (1.5, -0.5) O(-0.5, 1.5)

Answers

Answer:

Hi! The answer to your question is (3,0) Or just 3

Step-by-step explanation:

☆*: .｡..｡.:*☆☆*: .｡..｡.:*☆☆*: .｡..｡.:*☆☆*: .｡..｡.:*☆

☆Brainliest is greatly appreciated!☆

Hope this helps!!

Stay Safe!!

- Brooklynn Deka

Answer:

[tex] \boxed{(1.5, \: -0.5)} [/tex]

How many minutes are there between 15 minutes past 10 and 25 minutes to 11am?

Answers

Answer:

20 minutes

Step-by-step explanation:

15 minutes past 10 is 10:15

25 minutes to 11 am is 10:35

(60-25=35)

35-15=20

What is the mode of the data set ?
3,3,5,5,5,7,7,8,15,15

Answers

Answer:

Step-by-step explanation:

the mode is the number that appears most frequently on a data set.

Answer:

Step-by-step explanation:

find the area of the triangle
answer in digital format only

Answers

Answer:

Step-by-step explanation:

Assume that each cell on the grid represents one unit. One can use the formula, ([tex]A=\frac{(base)(hieght)}{2}[/tex]) to find the area of the triangle. One can see that the base of the triangle is, (11), and the height is (6). Substitute in the given values and solve for the area,

[tex]A=\frac{(11)*(6)}{2}[/tex]

[tex]A=\frac{66}{2}[/tex]

[tex]A=33[/tex]

luciana is adding water to a pool

Answers

Answer:

Step-by-step explanation:

It would be B because she is adding 9 gallons per minute so you will have to add that to the 12,000 gallons to get w.

the answer is B""""""""""

How many times bigger is 3 to the power of 15 compared to 3 to the power of 12?Explain your answer.

Answers

Answer: 3 to the power of 15 is 27 times bigger compared to 3 to the power of 12

Explanation:
3 to the power of 15 = 14348907
3 to the power of 12 = 531441

14348907 divided by 531441 = 27

Nina and Luca were told to draw a net for the three-dimensional figure shown below. Which statement about the
students' nets is true?

Answers

where’s the statements?

Answer:

Step-by-step explanation:

HELP PLEASE 15 POINTS

Answers

The answer is c hopefully it helps you

Help pleaseeeeeeeeeeeee

Answers

Answer:

option first is the right answer

The first one is the answer

The first sequence rule is multiply by 2 starting from 7. The second sequence rule is add 2 starting from 8. What is the first number that appears in both sequences?
Question 3 options:

10

14

18

28

Answers

The first and the second sequence are arithmetic and geometric sequence, respectively

The first number in both sequences is 14

How to determine the first number?

From the question, we have the following rules

Rule 1

Start = 7

Multiply by 2

Rule 2

Start = 8

Add = 2

So, the numbers in the sequence are:

Rule 1: 7, 14, 28, 56......

Rule 2: 8, 10, 12, 14, .....

By comparing the numbers in the sequence, we can see that the first number in both sequences is 14

Answers

Answer:

Step-by-step explanation:

Hey there. In the comments above, let's list these fractions and convert them into decimals for a more simple comprehension level:

0; 1/8; 3/8; 1/2; 5/8; 3/4; 7/8; and 1. The converted list below will correspond with these fractions in order:

0; 0.125; 0.375; 0.5; 0.625; 0.75; 0.875; and 1.00.

Looking at these decimals, 1.00 is the greatest amount as it is the only fraction that converted to a whole number.

the vertex of the parabola below is at the point (5,-3). which of the equations below could be the one for this parabola?

Answers

Answer: ty for the points

Step-by-step explanation:

x+-3(y+3)2+5

here's the question

Answers

Answer:

Step-by-step explanation:

perimeter (p) = 8 + 17 + 15 = 40

semi-perimeter (s) = p/2 = 20

Area = square root of s(s-a)(s-b)(s-c) where a,b,c are the sides of the triange by Herons formula.

Therefore, area = 20(20-8)(20-15)(20-17) = square root of 3600 = 60

PLZ HELP
Which is the sum of 3.15 × 10^7 +9.3 × 10^6 ? Write your answer in
scientific notation.
A. 4.08 × 10^7
B. 4.08 × 10^6
C. 0.408 × 10^8
D. 40.8 × 10^6

Answers

Answer: A 4.08x10^7

Step-by-step explanation:

Expanded form: 40800000

1. The number of Hamilton circuits in K15 is
A) 15!
B) 105
C) 14!
D) 15
E) None of these

Answers

Hamilton circuits in K15 have 14

write an expression for b divided by 6

(please only real answers, I am already failing I don't need more bs)

Answers

Answer:

Well divided by is basically he slash between the things so it would be

b/6

Step-by-step explanation:

÷ is basically (divided by) and whatever number comes first jsut write it like for example

10 divided by 4

10 / 4

Answer:

b/6

Step-by-step explanation:

dont you think thats a bit easy? B divided by six, b ÷ 6, b goes in the like box when u do long division and 6 is outside

A student claims that 3√80 is in the simplest radical form. Which statement is true?
A. The claim is correct because 80 is not divisible by three.
B. The claim is correct because 80 is not a perfect cube.
C. The claim is incorrect because 80 has a factor of 4.
D. The claim is incorrect because 80 has a factor of 8.
Don't put a link as the answer.

Answers

Answer:

Step-by-step explanation:

3[tex]\sqrt{80}[/tex] = 3 · [tex]\sqrt{4}[/tex]· [tex]\sqrt{4}[/tex] · [tex]\sqrt{5}[/tex] which simplifies to 12[tex]\sqrt{5}[/tex]

please help me, i will mark brainliest
The seventh grade class is putting on a talent show to raise money for a class trip. It costs $500 to rent the banquet hall they are planning on using. If they charge $15 per ticket, how many tickets do they need to sell in order to raise at least $1000?
Part A
The variable in this problem will represent the number of:
A- students
B- tickets
C- parents
D- money
Part B
Choose the correct inequality to represent the story problem:
A- 15x+500=1000
B- 15x-500≥1000
C- 15x+1000≥500
D- 15x-500≤1000
Part C
How many tickets do they need to sell? (Write your answer as an inequality)

Answers

Answer:

B-Tickets

B-15x-500≥1000

C-x≥100

Step-by-step explanation:

X is the variable because you need to find how many tickets need to be sold

The answer is B because they need to raise $1000 or more

15x-500≥1000 (add 500 to both sides)

15x≥1500

x≥100

Rotating the decagon by a multiple of ___ carries the decagon onto itself. Therefore, a rotation of ___ counterclockwise will carry the decagon onto itself. can reflect the decagon ___ different ways , including ____ ways using the lines of symmetry that pass through the midpoints of two opposite sides.
Which of the following the correct sequence to in the blanks above?

Answers

Answer: C

Step-by-step explanation:

i just did this problem and got it right

Decagon is a regular polygon with 10 sides. The correct option that fills up the blanks is given by: Option C: 36°, 72°, 10, 5

What is a decagon?

A decagon is a regular polygon with 10 sides.

As shown in the diagram attached below, the angle between two line segments connecting center and two adjacent vertex is of 36°.

Since rotating the decagon by that angle will land it in an unidentifiable way, as it looks alike, thus, rotating the decagon by a multiple of __36°__ carries the decagon onto itself.

Therefore, a rotation of _36 degree or 72 degree or any multiple of 36 degree__ counterclockwise will carry the decagon onto itself.

If we connect one vertex to opposite one, and flip it on that connecting line(this flip is called reflection), then the decagon will look same as before reflection.Thera are 5 such different lines.

Now in addition, we can connect lines from mid point of 1 side to other opposite side too. And this also can be done in 5 ways. On these connecting lines too, the decagon can be reflected onto itself.

Thus, we can reflect the decagon _5+5=10_ different ways. (these are the only ways, and it can be proven mathematically).

And including __5__ ways using the lines of symmetry that pass through the midpoints of two opposite sides

Thus, the correct option that fills up the blanks is given by: Option C: 36°, 72°, 10, 5

Learn more about reflection symmetry here:

https://brainly.com/question/7783612

Assuming y>0, which of the following expressions is equivalent to 8√18y^2−5√50y^2
A. −y√2
B. 7y√3
C. 24y√3−25y√2
D. 2y√2

Answers

Answer:the answer is A

Step-by-step explanation:

Evaluate the expression for r = 2.

17 + r =

Answers

17+r= 19 because you replace r with 2 since r equals too and you get 19

What is 3-(-7)+11-(9)

Answers

Answer:

Step-by-step explanation:

Answer:

Step-by-step explanation:

Just had to simplify the expression.

what is 8x9-6+7(5-4x8)

Answers

Answer:

8 x 9 − 28 x 8 + 29

Step-by-step explanation:

Other Questions

Fire: heat as night : darkness analogy luciana is adding water to a pool Jacob was assigned recently to a large team working on a major software release that was taking longer than expected. Jacob and the other latecomers into the project spent a month partnered with a senior programmer who went over the project in detail with them and got them up to speed. Unfortunately, this training put the project even farther behind schedule. After a few months of working on the project with many other programmers, Jacob's work output becomes noticeably lower than it was before when he was working independently. Jacob's reduced work output is most likely due to Help me out. Mathmatics someone help me with this please x/12-5>-2 please help A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include short interesting story book Refer to these stories from the Iliad: "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache."What is a theme in "Prologue: The Long Siege," "The Quarrel," and "Hector and Andromache" from the Iliad by Homer?It takes courage to admit mistakes.Gods are powerful forces.Gods act without motive.Great leaders listen to advice from others. Which detail from paragraphs 22-25 best supports the concept of the "democratization" of social media in paragraph 22?A "mainstream media and institutions tend to invisibilizewomen, Howard says, the truth is getting more and moredifficult to ignore as these women so visibly lead the charge (Paragraph 22)B "they're working on a Juneteenth celebration with food trucks, speakers and performers - something to bring people together as the nation commemorates the end of slavery" ( Paragraph 23)C "Thomas anticipates she'll be busy organizing more events throughout the summer" (Paragraph 24)D "We're going to be dedicating our time to this to make sure things actually happen, Thomas says." ( Paragraph 25) Not really a question but I searched most of my test questions on here and I made a 50. Is it just me or is it people putting wrong answers down How does learning a different language helps you with communication skills find the area of the triangle answer in digital format only Malcolm is filling bags with rice. He starts with a 5 1 over 4 pound container of rice and fills eachbag with pound of rice. How many bags of rice can Malcolm fill? Name that meme -For 50 Points The school nurse took care of five students on Monday and four of the five students had a cough. The school nurse determined that 80% of the students in her school were coming down with colds. Which of the following would best describe why her conclusion was invalid? Calculate the speed of an object that travels 75m in 15s. Write and Solve Equations-Word ProblemsFor each context, draw a model, write an equation, and then write a complete sentence to answer the question in the context. If you were asked to round the number 9.6173 to the nearest hundredths place, how many digits would you have after the decimal point? the process of preparing and setting up a software on a computer is called