If Casey deposits $16 into his lunch account each week, how much will be deposited in 5 weeks? If Casey decides to buy lunch for his friend at $3.00 per lunch, how many lunches can he buy his friend?

Answers

Answer 1

Answer:

The exact number would be 26.66666667 but it would be 26.

Step-by-step explanation:

Usually when dealing with decimals anything 5 and up would be rounded up but since we are dealing with money we don't round up. Since his friends lunch cost $3 every lunch the most he will be able to buy is 26. He will have about $2.5 left over which he cannot buy a lunch with so thats why you dont round up.


Related Questions

can ya smart people solove ths

Answers

it would equal 1. you need to do pemdas. so first thing add 1+2= 3. next multiply 3 times 2. Lastly divide 6 by 6 which equals 1

Answer:

[See Below]

Step-by-step explanation:

____________________

✦ Solve:

Divide: [tex]6[/tex] ÷ [tex]2=3[/tex]Add: [tex]1+2=3[/tex]Multiply: [tex]3*3=9[/tex]

____________________

So your answer would be:

[tex]\bold9[/tex]

____________________

~Hope this helps Mate. If you need anything feel free to message me.

[tex]-Your~ Friendly~ Answerer,~Shane[/tex]

What it the solution to this equation?
2x+3=x-4

Answers

Answer:

x = -7

Step-by-step explanation:

Solve for x:

2 x + 3 = x - 4

Hint: | Move terms with x to the left-hand side.

Subtract x from both sides:

(2 x - x) + 3 = (x - x) - 4

Hint: | Combine like terms in 2 x - x.

2 x - x = x:

x + 3 = (x - x) - 4

Hint: | Look for the difference of two identical terms.

x - x = 0:

x + 3 = -4

Hint: | Isolate terms with x to the left hand side.

Subtract 3 from both sides:

x + (3 - 3) = -3 - 4

Hint: | Look for the difference of two identical terms.

3 - 3 = 0:

x = -3 - 4

Hint: | Evaluate -3 - 4.

-3 - 4 = -7:

Answer: x = -7

....Help please I need help I-

Answers

10^-5 = 1/100,000

10^20 = 100,000,000,000,000,000,000

10^-12 = 1/1,000,000,000,000

10^0 = 1

10^3 = 1,000

10^-85 =  a very tiny number (basically 0)

Answer: 10^-85, 10^-12, 10^-5, 10^0, 10^3, 10^20

You can also see that it goes in order so the higher the power, the larger the number.

Duke is a part-time student at Horizon Community College. He currently has 22 credits, and he plans to take 6 credits per semester until he is finished.
Duke's friend Kila is also a student at the college. She has 4 credits and plans to take 12 credits per semester. After how many semesters will Duke and
Kila have the same number of credits?

Answers

Answer:

3

Step-by-step explanation:

22=6c=4+12c

    -6c      -6c

22=4+6c

-4   -4

18=6c

/6   /6

3=c

-6 ÷ -2 pls provide an explanation

Answers

Answer:

it would be 3 because a negative divided by negative is a positive

and 6/2=3

Rearrange the equation A=4xy to solve for X

Answers

Answer:

x = A / ( 4y)

Step-by-step explanation:

A = 4xy

Divide each side by 4y

A/ ( 4y) = 4xy/4y

A / ( 4y) = x

geometry, i have other questions ill post in a minute but i need the answers aaa

Answers

Answer:

Angle 6 = 91 degrees

Step-by-step explanation:

There are several ways you could use to find angle 6.

You could either find angle 5 then 6, 2, then 6, or 4 then 6 as they can all be found using the given angle with different rules.

First, we can find angle 5 using the corresponding angles rule which states that angles in the same corresponding quadrant are equal. That is angles that are in the same corresponding 'section' in their groups of angles at both intersect points. E.g. Angle 5 and 89 are corresponding angles, therefore angle 5 is equal to 89.

From here we can find angle 6 by using the rule that states that angles on a straight line add to 180. Angle 6 and angle 5 make up a straight line together which we know is 180 degrees. Therefore 180 - angle 5 = angle 6

180 - 89 = 91

Angle 6 is 91 degrees.

We also could have done this by first finding angle 2, which in on a straight line with the given angle. Therefore 180 - 189 = angle 2

Angle 2 = 91

Then used the corresponding angle rule to find angle 6. Angle 2 = Angle 6

Angle 6 = 91.

The final way we could have found it is by finding angle 4 first. The opposite angles rule states that opposite angles sharing a vertex are equal. This means that 89 and Angle 4 are equal. From there we can use the co-interior rule which states that angles in the same 'section' between parallel lines are co-interior (Angle 4 and angle 6) and are equal.

Therefore angle 4 = angle 6

Angle 6 = 91

Sorry if this answer was a bit confusing, hope it helps!

is -3 plus pi a rational number or a irrational number

Answers

Answer:

irrational

Step-by-step explanation:

An irrational number has an endless number of digits to the right of the decimal

Name: Pres

How many 7/8 cup servings are in a pitcher that contains 8 1/4 cups of fruit punch?

Answers

Answer:

9 and 3/8 left over

Step-by-step explanation:

to calculate this you have to convert the cups to eighths so:

8 cups*8= 64/8

1/4*2= 2/8

64/8+ 2/8= 66/8

66 divided by 7= 9 and 3/8

What evidence is there that a chemical reaction is taking place in the cold pack?
A)
change in odor
B)
change in color
0)
formation of gas
D)
temperature change

Answers

The correct answer would be D
D.) temperature change

Please help me with my homework

Answers

Answer:

49/30

Or

1 19/30

Step-by-step explanation:

What is the slope of the line in the graph?
y
01
4.
3
2.
1
-5 -4 -3 -1
1 2 3 4 5 X
T Ym T
-5

Answers

Answer:

2

Step-by-step explanation:

Slope is Y/x. In this case, you could do 4 /2 which would give you a slope of 2/1=2.

Answer:

1

Step-by-step explanation:

rise 1 over run 1 1/1=1

f(n) = -5n +4 ; find f(3)
what is the term given in this position?

Answers

The term given is -8

PLEASE HELP WILL MARK BRAINLIEST (MAKE SURE TO ADD THE STEPS PLEASE)
-1^2 - 2(8) + 7(4)

Answers

Answer:

=11

Step-by-step explanation:

= -1 - 2(8)+7(4)

=-1-16+7(4)

= -1-16+28

=11

Step-by-step explanation:

-1^2-16+28

-1^2+12

-1+12=11

Evaluate f(x) = X(With an exponent of 2) -3x +2, given f(x + 1).

Answers

Answer:

f(x + 1) = x² - x

Step-by-step explanation:

f(x) = x² - 3x + 2 when f(x + 1)

f(x + 1) = (x + 1)² - 3(x + 1) + 2

f(x + 1) = (x² + 2x + 1) + (-3x - 3) + 2

f(x + 1) = x² - x + 0

f(x + 1) = x² - x

Best of Luck!

solve x -5y = 6 for x​

Answers

Answer:

x=5y+6

Step-by-step explanation:

If a polygon has exactly 4 sides, it is a quadrilateral. State the contrapositive of the conditional statement. A) If a polygon is a quadrilateral, it has exactly 4 sides. B) If a polygon is a quadrilateral, it does not have exactly 4 sides. C) If a polygon is not a quadrilateral, it does not have exactly 4 sides. D) If a polygon does not have exactly 4 sides, it is not a quadrilateral.

Answers

Answer: I think the answer is D

Step-by-step explanation:

Option - C is the correct option.

We have a statement - If a polygon has exactly 4 sides, it is a quadrilateral.

We have to write the contrapositive of this conditional statement.

What do you mean by Contrapositive of the Conditional statement ?

A combination of the converse and the inverse is called Contrapositive of the Conditional statement. Contrapositive will replace if with then and vice - versa and after that both parts are negated.

According to the question, we have a statement -

If a polygon has exactly 4 sides, it is a quadrilateral.

Firstly, replace ' if ' with ' they ' and vice - versa. We get -

If a polygon is a quadrilateral, than it does have exactly four sides.

Now, negate it -

If a polygon is not a quadrilateral, it does not have exactly 4 sides.

Hence, Option C is correct.

To solve more questions on contrapositive of the conditional statement, visit the link below -

https://brainly.com/question/17870378

#SPJ6

PLEASE ANSWER IMMEDIATELY, I'LL GIVE BRAINLIEST AND POINTS!!

Answers

Answer:

8000

Step-by-step explanation:

8000

10^6-2*7.2/9

72000/9 = 8000

Tanya typed 160 words in 5 minutes on her essay for Spanish class

Answers

... not enough information to answer

Answer:

she typed 32 words in 1 minute

Step-by-step explanation:

Which equation shows a proportional relationship? *

y= -2x +5
y= 3+ 5x
y= -3x

Answers

Answer:

y= -3x

Step-by-step explanation:

The graph of a line with a proportional relationship would have the line go through the origin.

Since the 'y=-3x' equation only shows the slope of the line, it goes through (0,0), or the origin, as it's y-intercept.

y= -3x should be the correct answer.

Hope this helps.

James rides the train from Center City to Lakeside. The train ride
lasts for 18 minutes. The train arrives at the Lakeside station at
9:12 A.M. What time did the train ride start?

Answers

Answer: 8:54

Step-by-step explanation:

Answer:

8:54 A.M.

Step-by-step explanation:

When you subtract 12 minutes from 9:12 A.M., you get 9 am. Then you still have to subtract 6 more minutes from 9:00 A.M. and you get 8:54 A.M.

Prove angle FGH is congruent to angle HIF.


A.
1) Given
2) Given
3) Reflexive property of congruency
4) SAS
B.
1) Given
2) Reflexive property of congruency
3) Given
4) AAS
C.
1) Given
2) Reflexive property of congruency
3) Given
4) SSA
D.
There is not enough information to prove the triangles congruent.

Answers

Answer: someone please answer :(((

Step-by-step explanation:

fire^#^#&÷^4&4<×^#^÷​

Answers

That is not a question I can answer

Answer:

Can you construct the question better.Maybe then I would be able to answer it.

If f(x) = - 2x + 3 then f(3) - f(4) =

Answers

Answer:2

Step-by-step explanation:

I have the problem on my my review and it says 2

Substituting the given values of X into the function, the value of f(3) - f(4) is 2

Given the function :

f(x) = - 2x + 3

f(3) = - 2(3) + 3

f(3) = - 6 + 3 = - 3

For X = 4 :

f(4) = - 2(4) + 3

f(4) = - 8 + 3 = - 5

f(3) - f(4) = - 3 - (-5)

f(3) - f(4) = - 3 + 5 = 2

Therefore, the value of f(3) - f(4) is 2

Learn more : https://brainly.com/question/18106342

For a business meeting, Jenna is making copies of her presentation. The more people
who plan to attend, the more copies Jenna will have to make.
Which of the variables is independent and which is dependent?
Independent (Select]
<
Dependent [Select ]

Answers

Answer:

Independent: The people who attend.

Dependent: The copies she has to make.

Step-by-step explanation:

She will make a certain amount of copies depending of how many people attend.

Maxine bought 3 bags of oranges and a bag of apples. The bag of apples cost $4. Brody bought 2 bags of oranges and a cake. The cake cost $9. Maxine and Brody spend the same amount of money on their shopping trips. Which equation represents the cost of each bag of oranges (c)?

Answers

Answer:$4.30, if your rounding but if not $4.33

Step-by-step explanation:

Last August, the Martin family paid 75 for home owners association fee in February,they paid 54 what is the percent of decrease

Answers

Answer:

21% decrease

Step-by-step explanation:

just took 75 _ 54 and came up with 21 and juat added the % to it

Choose the student who wrote the correct inequality.

Vrinda made over 90% of her free throws during the basketball game.
Isidro's work. F = 90.
Kimani's work. V less-than 90.
Tori's work. P greater-than 90.

Answers

Answer:

Tori

Step-by-step explanation:

if youre making over 90 percent of your free throws, then any number (P) greater than 90 is the answer

Answer:Toris work;Greater than 90.Because 90% has to be greater and not less.~Empress Arianna Mcdonald.

what is the ratio of softballs to the total number of balls if there are 3 softballs and 184 is the total?​

Answers

i divided 3 (softballs) into 184 and i got 1/61 (rounded down) so for every 1 softball theres 61 other balls.
hope this helped!

Step-by-step explanation:

Question:-

what is the ratio of softballs to the total number of balls if there are 3 softballs and 184 is the total?

Answer:-

Ratio will be according to given units.

So, Softball : Total Balls

3: 184

Since it cannot be simplified further this is the answer.

Hope it helps ☃️

What is the probability of flipping at least 2 heads? As a Fraction

Answers

Answer:

81/100

Step-by-step explanation:

flipping a coin one, two, three or four times. 0.81 is the probability of getting 2 Heads in 5 tosses.

Other Questions
HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer