how would you make an extract of a food to test for reducing sugar​

Answers

Answer 1
To test for the presence of reducing sugars, a food sample is dissolved in boiling water. Next, a small amount of Benedict's reagent is added and the solution begins to cool. During the next four to 10 minutes, the solution should begin to change colors. If the color changes to blue, then no glucose is present. If a high amount of glucose is present, then the color change will progress to green, yellow, orange, red and then a dark red or brown.

Related Questions

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

There is the picture to the question

Answers

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

Please help due in 10 minutes!
Explain how genetic drift of alleles in a small population- and- describe 2 real world examples of genetic drift (I.e. The Founder Effect and The Bottleneck Effect)

Answers

Answer:A small population is formed with a larger population.

Explanation:The population don’t represent the genetic diversity’s of the original

Population, and there smaller size mean they may experience strong drift of generations.

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

The farmer realizes he could sell mini-dragons as pets, but doesn't want them to breathe fire, because that would be dangerous. Suggest two parental genotypes for parents that would produce mini, non-fire breathing dragons.

Answers

Answer:

ddff  and DDFf

Explanation:

From the information given:

Let DD represents the dwarf traits and FF represents the ability for the dragons to breathe fire.

Also, if dd represents the normal traits and ff represents the inability of the dragons to breathe fire.

Then; we can cross a dominant trait for dwarfism which has a heterozygous trait for fire with a recessive trait of normal and nonfire.

The two parental gametes are: ddff  and DDFf

Using a Punnet Square:

         DF              Df

df      DdFf           Ddff

df      DdFf           Ddff

From above; we could observe that the proportion of progenitors that will be dwarf and at the same time unable to breathe fire is 50%.

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

What is true about the insanity defense?

It is defined in the Diagnostic and Statistical Manual of Mental Disorders.
It can be used only if a person is diagnosed with a specific disorder from the DSM.
It is a legal term used to determine if a person can be held accountable for a crime.
It is a legal term that helps to determine if a person committed a crime or not.
It cannot be used if a person was previously found to be responsible for a different crime.

Answers

It is a legal term used to determine if a person can be held accountable for a crime

It's a legal term used to determine if a person can be held accountable for a crime. Hope this helps; have a wonderful day.

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

Answer fast please. !!!!!!!!!!!!!!!!!!A geologist who needs to curricula to rock formations in different areas can match exposed rock layers
true or false

Answers

Answer:

A geologist who needed to correlate two rock formations in different areas could match exposed rock layers? A geologist who needed to correlate two rock formations in different areas could match exposed rock layers. TRUE.Explanation:

Answer:

true

Explanation:

What does the brain stem do?

Answers

Help you out with anything you’re having trouble with

Answer:

It connects the rest of the brain to the spinal cord, which runs down your neck and back. The brain stem is in charge of all the functions your body needs to stay alive, like breathing air, digesting food, and circulating blood.

Explanation:

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

Other Questions
POEM: ARROW AND THE SONGI shot an arrow into the air,It fell to earth, I knew not where;For, so swiftly it flew, the sightCould not follow it in its flight.I breathed a song into the air,It fell to earth, I knew not where;For who has sight so keen and strong,That it can follow the flight of song?Long, long afterward, in an oakI found the arrow, still unbroke;And the song, from beginning to end,I found again in the heart of a friend.What do you think the effects of the arrow and the song, as revealed in the final stanza of the poem, are meant to suggest about human actions and their consequences? what form is the equation 12y=2x=24 un pantaln se fabrica con 3/7de tela.Cuntos pantalones se pueden hacer con 36 metros de tela ? How did German territorial losses lead to World War II?The Soviets were angry about not receiving territory, leading to expansion attempts in Eastern Europe.Ethnic divisions in Czechoslovakia caused conflicts between competing international alliances.Germans resented losing territory to the new Poland, which fueled nationalistic tendencies.French grievances about Germanys nonpayment of war damages caused France to demand more land. A rectangular paddock has perimeter 100 m. Find the width of the paddock if its length is 30 m. the area if a rectangle is 7 with leangth 2/ calculate its breadth I need help with 4,5,6 Why do you think males and children are more likely to die from DHMO Is anyone able to translate these TwT April wrote two equations to represent this system of equations. She wrote: y = 5x +I and y = 14x - 10. Do you agree or disagree with April? Why did most Japanese Americans accept internment?They wanted to prove their loyalty by obeying the order.They thought it was constitutional.They knew it was pointless to protest it.They felt safer living far away from other Americans. After his wife's death, Macbeth realizes that the witches' predictions are becoming horrible realities, but he believes thatQuestion 30 options:the witches have better predictions to tell him.Macduff will have mercy on him.he can overcome Malcolm and remain king.he will die bravely and defiantly in battle. A store sells hardcover books for $8 and paperback books for $5. You buy 9 books, represented by the equation x+y=9, where x is the number of hardcover books and y is the number of paperback books. The equation 8x+5y=51 represents the total cost. How many of each type of book did you buy? PLZ HELPJonathan is scanning an old photograph that he wishes to restore. What is the optimal size he should specify for the scanned image as compared to the size of the original photo?A. the same size as the original photoB. a size larger than the original photo C. a size smaller than the original photoD. a size much smaller than the original photoJonathan is scanning an old photograph that he wishes to restore. What is the optimal size he should specify for the scanned image as compared to the size of the original photo? A. the same size as the original photo B. a size larger than the original photo C. a size smaller than the original photo D. a size much smaller than the original photo According to the Base Pair rule, Cytosine always pairs with 2. On the line below, create a bulleted list, using the square bullet option, of the following parksand recreational areas in the United States: Blue Ridge Parkway, Golden Gate NationalRecreation Area, Great Smoky Mountain National Park, Gateway National Recreation Area, andLincoln Memorial. PLs help me....I'm lazy 0-0 40 points!Wright a poem about the ocean it doesn't have to be long but please not to short PLSS HELP ME it will be worth a lot of points! global warming is caused by an increase in the amount of ___ can you say it in order ... is an actual sequence of interactions (i.e., an instance) describing one specific situation; a ... is a general sequence of interactions (i.e., a class) describing all possible ... associated with a situation. ... are used as examples and for clarifying details with the client. ... are used as complete descriptions to specify a user task or a set of related system features.