How does food provide energy and matter for organisms?​

Answers

Answer 1

Answer:

Food provides the molecules that serve as fuel and building material for all organisms. Plants use the energy from light to make sugars from carbon dioxide and water. ... Organisms Explanation:


Related Questions

The process of meiosis is illustrated here. The outcome of meiosis is very important in the sexual reproduction and life cycle of
diploid organisms. Evaluate these statements and determine which ones accurately describe the outcome of meiosis. You may select
ALL that apply.
-)
A)
Meiosis produces genetically diverse cells.
B)
Meiosis increases genetic variation in the offspring.
C)
Meiosis produces haploid cells from a diploid parent cell
D)
Meiosis increases the genetic content in the daughter cells.
E)
Meiosis maintains the number of chromosomes originally present in the
parent cell.

Answers

Answer:

A) Meiosis produces genetically diverse cells.

B) Meiosis increases genetic variation in the offspring.

C) Meiosis produces haploid cells from a diploid parent cell

Explanation:

Through crossing over, meiosis produces genetically diverse cells causing more genetic variation of offspring. The Daughter cells in meiosis are formed from a diploid cell that has all 46 chromosomes, however the daughter cells are haploids as they need to join with the other gamete to have a full set of chromosomes.

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

Which structure in the heart'separates
oxygenated blood from deoxygenated blood?

Answers

Answer:

pericardium

Explanation:

A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

What is the slowest moving weather front. Why
is it so slow?

Answers

Answer:

Cold fronts

Explanation:

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

how did natural disasters affect animal populations?​

Answers

Answer:

When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need

Explanation:

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

You suggest using a logistic growth model instead. Your colleague agrees, and recommends harvesting the bass population down to just under carrying capacity. Their argument is that the population will remain large and population growth will be fastest if it is harvested down to this size. A) Why is this argument incorrect

Answers

Answer and Explanation:

The error of this argument is to state that a population will remain large and increase when it is close to the carrying capacity. This is because the carrying capacity is the term that determines that a population of living beings is living in an environment that has the minimum resources for their survival, because that population has already consumed the resources. In this case, when a bass population comes close to carrying capacity, the amount of environmental resources is starting to become scarce or limited, this will cause a decrease in the size of the population, because many members of the population will not have access to the necessary resources and will die, decreasing the population. In addition, reproduction among members of the population will be reduced, which will prevent the population from remaining large, since the mortality rate will be higher than the birth rate.

Please select the word from the list that best fits the definition

movement of molecules from an area where there are many to an area where there are few

Answers

Answer:

Diffusion

is the movement of molecules from an area where there are many to an area where there are few

Hope it helps

which statement is correct about the polarity of a water molecule

Answers

Answer:

Water is Polar

Explanation:

There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.

Water is polar good luck

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.
Other Questions
the development of the juvenile justice system was not initially concerned with what? What party leads the senate? Describe the progressive era in 5 sentences A local bakery called Brianny's makes 100 batches of cookies in 4 hours. If they keep this pace, how many batches of cookies would they make in 16 hours? How did the American Revolution change the World? Sarah needs help with a presentation that she is giving the next day. What are the best ways for her to share her work to get immediate feedback? Check all that apply. with editing rights via email as a PDF file through OneDrive with read-only options via email with editing rights through OneDrive as a Word document through Office365 with commenting rights through Office365 with PowerPoint Online comment accessibility What's the difference between a drugs brand name and generic name ?Plz help 1. When did Israelis capture the rest ofJerusalem? Helppp, 60 points!!! Find the circumference of the given circle please Re-type the sentence correctly."well," she said, "you may be right." Please help asap oiuytyghjkjhugytfhjkl pleasee!! i rly need this one If I have a 50 liter container that holds 45 moles of gas at a temperature of 200 0C, what is the pressure inside the container? Rewrite the expression by combining like terms.3x^2 + y + 2y^2 + 4y^2 HALP ME PLZZ ASAP NO LINKS my sister is 14 years older than I. her current age is 43. if p represent my current age then set up a equation for my sister's age Hamid is going to heat sodium chloride and water in a beaker. How can he carry out his experiment assafely as possible?[4 marks] is charli d'amelio getting abuse ple help due tonight Please help John had his annual physical with his physician and after receiving his blood work results, his doctor is concerned. Johns total cholesterol is 309. His HDL is 25 and his LDL is 220. His triglycerides are 320. John eats fast food every day, usually twice per day. His favorite restaurants are Kentucky Fried Chicken and McDonalds.What is the risk of having an HDL of 25?What are healthy ranges for total cholesterol, HDL, LDL, and triglycerides?