how did the frame shift change the amino acid

Answers

Answer 1

During translation, the sequence of codons is read in order from the nucleotide sequence to synthesize a chain of amino acids and form a protein.

Therefore, frameshift mutations result in abnormal protein products with an incorrect amino acid sequence that can be either longer or shorter than the normal protein.

Hope this helped!


Related Questions

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

What is often a problem when calibrating a molecular clock?
A. There are frequently not enough negative mutations to accurately calibrate the clocks.
B. There are many different clocks, each of which "ticks" at a different rate.
C. The clocks use mutations that are difficult to identify and track.
D. The frequency of crossing over is used to calibrate the clocks.​

Answers

Answer:

cevabın C olduğunu düşünüyorum

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

Put "Genetic Variation" in a sentence

Answers

Answer: British populations lack detectable genetic variation, suggesting a strong founder effect.

hope it will be helpful.

Mutations can often cause genetic variation.


Hope that helps!

The farmer realizes he could sell mini-dragons as pets, but doesn't want them to breathe fire, because that would be dangerous. Suggest two parental genotypes for parents that would produce mini, non-fire breathing dragons.

Answers

Answer:

ddff  and DDFf

Explanation:

From the information given:

Let DD represents the dwarf traits and FF represents the ability for the dragons to breathe fire.

Also, if dd represents the normal traits and ff represents the inability of the dragons to breathe fire.

Then; we can cross a dominant trait for dwarfism which has a heterozygous trait for fire with a recessive trait of normal and nonfire.

The two parental gametes are: ddff  and DDFf

Using a Punnet Square:

         DF              Df

df      DdFf           Ddff

df      DdFf           Ddff

From above; we could observe that the proportion of progenitors that will be dwarf and at the same time unable to breathe fire is 50%.

4.Paramecium is able to move by hairlike structures called
____

Answers

Answer:

Cilia

Explanation:

           

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

In three to five sentences, construct an argument that shows why lichens are necessary to establish a new ecosystem after an extreme disturbance.
I would really appreciate it if someone o two people would help me out on this one

Answers

Answer:  Lichens affect every species in the ecosystem, in 2013 Russia had a dramatic lichen die off which caused 61,000, 20% of the entire reindeer population to die from starvation. And with fewer deers, the bears and wolves also suffered from the loss of lichens and if it takes a long time for lichens to grow back in an ecosystem, animal declines may take years if ever to be corrected.  Lichens serve as a basis for several food chains, especially in artic communities.

The argument which shows why lichens are necessary to establish a new ecosystem is as follows;

Lichens are known to enable algae to live all over the world in many different climates.

On this note, lichens also provide a means to convert carbon dioxide in the atmosphere through photosynthesis into oxygen, a process required by all to survive.

Additionally, lichens provide us with valuable information about the environment around us.

On this basis, lichens are important for establishing a new ecosystem after an extreme disturbance.

Read more on lichens and the ecosystem;

https://brainly.com/question/1504278

Select the item(s) that describe a producer.

1.takes energy from the sun
2.helps rot dead organisms
3.fungus
4.tall grass
5.food is mostly animal
6.plant eater
multiple choice

Answers

Answer:

3. fungus

4. tall grass

5. food is mostly animal

The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect does this mutation have on the individual? WILL GIVE BRAINLIEST
The individual suffers from sickle cell anemia.

The individual suffers from myotonic dystrophy.

The individual suffers from Fragile X syndrome.

The individual suffers no negative effects.

Answers

i believe it to be the first one

Answer:

The individual suffers from sickle cell anemia.

Explanation:

Deformed red blood cells occur in 1 in 500 African Americans. This is caused due to a gene mutation called point mutation that alters the structure of the red blood cell. This alteration affects the cell's ability to carry oxygen.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

1. Shivering when you are cold is an example of your body trying to maintain
homeostasis.
a. True
b. False

Answers

Answer:

true

Explanation:

When the core body temperature drops, the shivering reflex is triggered to maintain homeostasis. Skeletal muscles begin to shake in small movements, creating warmth by expending energy. Shivering can also be a response to a fever, as a person may feel cold.

Which is the last link in the wetlands food chain?
A. Consumers
B. Predators
C. Decomposers
D. Producers

Answers

It should be C. decomposers

Answer:

BRO THE CORRECT ANSWER IS .... C) DECOMPOSTER

Explanation:

I KNOW IT IS SAME BUT STILL YOU CAN MARK ME AS BRAINIEST

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

PLS HELP ILL MARK BRAILIEST
Spend one minute writing an explanation of
the FUNCTION of enzymes. YOU MUST USE
THE WORDS CATALYST, ACTIVATION
ENERGY, RECYCLABLE

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions. Activation energy is the energy needed to start a chemical reaction. This is illustrated in Figure below. The biochemical reaction shown in the figure requires about three times as much activation energy without the enzyme as it does with the enzyme.

The reaction represented by this graph is a combustion reaction involving the reactants glucose (C6H12O6) and oxygen (O2). The products of the reaction are carbon dioxide (CO2) and water (H2O). Energy is also released during the reaction. The enzyme speeds up the reaction by lowering the activation energy needed for the reaction to start. Compare the activation energy with and without the enzyme

Answer:

Enzymes help speed up chemical reactions in the human body. They bind to molecules and alter them in specific ways. They are essential for respiration, digesting food, muscle and nerve function, among thousands of other roles.

What is the function of an enzyme? They allow chemical reactions to occur at normal body temperature fast enough to sustain life. They reduce the activation energy needed to start a chemical reaction.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

Enzymes create chemical reactions in the body. They actually speed up the rate of a chemical reaction to help support life. The enzymes in your body help to perform very important tasks. These include building muscle, destroying toxins, and breaking down food particles during digestion.

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

Please help due in 10 minutes!!!
Explain the 5 ways to reach Hardy-Weinberg equilibrium, does this mean evolution is occurring?

Answers

There are five basic Hardy-Weinberg assumptions: no mutation, random mating, no gene flow, infinite population size, and no selection. If the assumptions are not met for a gene, the population may evolve for that gene (the gene's allele frequencies may change).

A cell is placed in a hypertonic solution. Which will most likely occur as homeostasis is maintained in the cell?

A.
The cell will gain ATP molecules.

B.
The cell will gain water.

C.
The cell will lose water.

D.
The cell will lose sodium ions.

Answers

Answer:

B the cell will lose water

Explanation:

Because of the hypertonic solution water will move on the concentration gradient leaving the cell and entering the solution. Thus the cell looses water.

When a cell is placed in a hypertonic solution, it will most likely lose water (Option C) as homeostasis is maintained in the cell.

What is homeostasis?

Homeostasis is the ability of an organism or a system to maintain a relatively stable internal environment, despite changes in external conditions. It is a key aspect of biology that helps living organisms survive in their environment. Homeostasis is maintained through a series of physiological processes that regulate different aspects of an organism's biology, such as temperature, fluid balance, and pH

A hypertonic solution is one that has a higher concentration of solutes (e.g. salts) outside the cell compared to inside the cell. This creates an osmotic pressure gradient, which draws water out of the cell and into the solution in an attempt to balance the concentration of solutes on both sides of the cell membrane. As a result, the cell will shrink and lose water.

Learn more about homeostasis, here:

https://brainly.com/question/29776080

#SPJ6

SOMEONE PLEASE ANSWER OMG



Considering that different types of cells have different rates of mitosis,
which of the following would be a correctly finish this statement? Cell
types like skin and hair are damaged and need replaced more often than
liver cells; therefore ......
Liver cells would have MORE cells doing Mitosis and Apoptosis compared to
Skin/Hair cells
Liver cells would have LESS cells doing Mitosis and Apoptosis compared to Skin/Hair
cells
Liver cells would have the SAME amount of cells doing Mitosis and Apoptosis
compared to Skin/Hair cells

Answers

Answer:

OMGGGGHHHHVGGGGGGGGG

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)


ste
Class
Lesson Uutine
Levels of Organization
A Lite's Organisation
1. A large animal is composed of trillions of tiny
together
organisms are made of only one cell.
working

Answers

Answer:Life's Organization. 1. A large animal is composed of trillions of tiny cells working together. 2. Unicellular organisms are made of only one cell. B.

Explanation:

Can someone help me fill in the blanks. Thank you.​

Answers

Answer:

1) fungi

2) tubers

3)bulbs

4) unequally

5) cuttings

6)equally

7)root

8) mitosis

this my knowledge on this questions...hope i helped!

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

Other Questions
2. Suppose a person traveled along the Congo River from the Congo Basin to the Atlantic Ocean? In what general direction would thatperson be traveling?3. Using directional terms, how would you describe the location of the AmharaPlateau in relation to the Kalahari Desert? The agriculture economy of the 19th century south is also referred to as A) industrialization systemB) agricultural revolution C) nationalist policy D) plantation system In TUV, t = 410 cm, U=27 and V=78. Find the length of v, to the nearest 10th of a centimeter.= umm what is this????? What is the net force in this image? a8000 N right b5000 N right c4000 N right d4000 N left e5000 N left f8000 N left Julie's brother says that instead of paying her the $40 he owes her, he will give her$2 today and double the amount she has each day for 6 days. Should Julie accepther brother's offer? Why or why not? Can u please help mee?1 Calculate the momentum in each of these cases. a A car of mass 1000 kg traveling at 31.6 m/sb A train with a mass of 120 000 kg and a velocity of 40 m/s (about 90 mph) True or false: Everything in the universe works with harmony because of balanced energy IIn which book of original entry would you enter the following?(a) Sales invoice(b) Debit note-(c) Cash sale-(d) Purchase invoice-(e) Credit note- Looking back at your life, how has technology changed and how has it changed your life? What are some positive aspects of this change and some negatives? How do you anticipate that technology will change the lives of your children in relation to your own life? Create an expression that is equivalent to 9(3x + 5 + x) without usingparentheses. 3. Curve Number and SCS Travel Time Assignment (2 pts) You need to calculate the curve number for a site which is composed of: 25 acres industrial buildings, 125 acres 1 acre lots, 60 acres parks/open space with good cover, 40 acres of commercial development, and 225 acres of meadows. The soil was determined to be 50% Sand, 25 % Silt and 25% Clay. a. Determine the Soils Type b. Determine Curve Number for AMC III. Find the area of the trapezoid The Teller Amendment was added to the American declaration of war against Spain in 1898 to A. forbid expansion of Southern cotton interests into Cuba in the event that the country won the war against Spain. B. renounce any American claims to Cuba but leave open the possibility of acquiring other Spanish territories. C. expand the theater of warfare to the South Pacific. D. renounce any intention on the part of the United States to acquire Spanish territory. 1 point8. Find a positive angle that is less than 360 that is coterminal with a -80angle*260440-440None of the above If I have $25.2, would it be $25.02 or $25.20? Add or remove commas, if necessary, until the sentence has correct punctuation.Twigs, and string are important materials for Pua's artproject. 1.A five - layer of cake weighs half a kilogram per layer.In each layer,the cake is decorated with icing which weighs 15g.3 candles which weighs 100g each is added.What is the total weight in kilogram of the fully decorated cake? I need help as soon as possible I NEED HELP PLS ASAP