Hey
How do you take good notes? and study them

Answers

Answer 1

Answer:

i don't really take notes sorry

Explanation:

Answer 2

Answer:

If you want to take good notes you must find your own way to remember them

Explanation:


Related Questions

If 5x+4y=58 and 3x + 7y = 67 find the value of ( x + y ) ​

Answers

Explanation:

5x + 4y = 58 ....1

3x + 7y = 67 ....2

....1 × 3 both sides of the equation

15x + 12y = 174 ....3

....2 × 5 both sides of the equation

15x + 35y = 335 ....4

.....4 - ......3 both sides of the equation

35y - 12y = 335 - 174

23y = 161

y = 161/23

= 7

write the names of Institute which involved in research of viruses
plz tell me fast​

Answers

Answer:

The National Institute of Virology, Pune is an Indian virology research institute, and one of the translational science cells part of Indian Council of Medical Research (ICMR). It was previously known as 'Virus Research Center' and was founded in collaboration with the Rockefeller Foundation.

Which specialized cell type would be found lining the trachea, the part of the body that brings air to the lungs?
A)blood
B)epithelial cells
C)neuron
D)muscle cells

Answers

Answer:

epithelial cells

Explanation:

I hope it works <3

Answer:

Blood

Explanation:

Red blood cells are responsible for transporting oxygen to the different parts of the body.

Which list places the layers of the sun in the correct order from innermost to outermost?

Corona, photosphere, chromosphere
Photosphere, convective zone, radiative zone
Convective zone, chromosphere, corona
Radiative zone, corona, convective zone

(the third choice is wrong)

Answers

Answer:  The inner layers are the Core, Radiative Zone and Convection Zone. The outer layers are the Photosphere, the Chromosphere,

Explanation: Hope this helped! :)

Which phrase describes one main feature of the atmosphere

Answers

Answer:

protects earth's surface

I hope this helped you!

Which statement does NOT accurately describe eukaryotic and prokaryotic cells?

Answers

Answer:

You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.

For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.

Prokaryotic cells are found in the domain(s) Bacteria and Archaea.

True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.

A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.

There is only  _1_ eukaryotic domain, it is Eukarya.

what is the relation between weight of the body and weight of the heart​

Answers

300g in males 200g in females

Which statement is true? a. Earth’s revolution is circular. b. Earth’s revolution is elliptical. c. Earth’s distance from the Sun is constant. d. Earth’s average distance from the Sun is 2 astronomical units.

Answers

Answer:

B

Explanation:

Help I don’t get it the last one says negative

Answers

Answer:

Negative (Fourth Choice)

Explanation:

According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.

2. What is the process of making energy within mitochondria called?

Answers

Answer:

Mitochondria Function

Explanation

Cellular respiration is the process of making ATP using the chemical energy found in glucose and other nutrients. In mitochondria, this process uses oxygen and produces carbon dioxide as a waste product.

I took biology last year so I had to dig out my old notes. The correct answer should be mitochondria function. good luck :)

What property causes the cohesion of water molecules that moves water through a plant against the force of gravity?

Answers

Answer:

I believe the answer is polarity, though I am unable to find an exact statement.

Explanation:

I believe it is polarity because of the way water moves through a plant and its relation to gravity.

Each student in a science class of 25 performed the same experiment. Each student shares their data and it is
recoded on a class data table. Tamara compared the data that she personally collected in her experiment to the
data collected by the rest of her classmates.
Which of the following might indicate to her that her results are valid?

Answers

Answer: three other classes performed the same experiment.

Explanation:

(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?

Answers

Answer:

Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.

Explanation:

Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!

HELPPPPPP ME PLEASEEE

Answers

Answer:

building blocks of life

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. 

HELP ASAP 20 POINTS!!!!!!!!!!!!
2 ANSWERS

Answers

Answer:

A, and D

Explanation:

its the answer I believe

Answer:

Nitrogen, Calcium

Explanation:

im pretty sure.

Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?

Answers

Answer:

DNA ligase

Explanation:

Answer: The nucleus

Explanation: I got it right on the test.

A man is 1.7 m long. An amoeba is 17 um long. How does the length of the
man compare to the length of the amoeba?

Answers

A man is 100,000 times larger in micrometers than the amoeba, since 17 micrometers is 0.000017 meters, and 1.7 meters is 1,700,000 micrometers

explain how matter behaves differently than energy in a ecosystem

Answers

Answer:

Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.

Which of the following is not true about prokaryotic cells?

Answers

Answer:

Prokaryotes lack a true nucleus with well defined nuclear membrane and other membrane-bound organelles. Mitochondria are the double membrane bound organelle and hence is absent in prokaryotes. Mesosome is an extension of the cell membrane presence in the cytoplasm as infolding and serves to increases surface area and as a site for cellular respiration in prokaryotes. Histones are positively charged proteins that serve in the packaging of negatively charged eukaryotic DNA but are absent in prokaryotes.

So, the correct answer is option A.(DNA is complexed with histones).

The statement which is not true for prokaryotic cell is that they are all parasitic. Thus, the correct option is C.

What is Prokaryotic cell?

Prokaryotes are the organisms whose cells lack a nucleus and other membrane-bound organelles. Prokaryotic organisms are divided into two distinct groups which are the bacteria and the archaea, which scientists believe to have the unique evolutionary lineages. Most of the prokaryotes are small in size, single-celled organisms which have a relatively simple structure.

Examples of prokaryotic organisms are blue-green algae, bacteria and mycoplasma. Among the prokaryotes, bacteria are the most common and multiply very fast.

Therefore, the correct option is C.

Learn more about Prokaryotic cell here:

https://brainly.com/question/18348786

#SPJ6

Your question is incomplete, most probably the complete question is:

Which one of the following is not true of prokaryotes ?

(a) They are living cells

(b) They lack a nucleus

(c) They all are parasitic

(d) They are both archaea and bacteria

You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment

Answers

Answer:

C. Hypothesis

Explanation:

Number 15 which of the following is a function of carbohydrates?

Answers

Answer:

Option (c) cell wall.  

Explanation:

Carbohydrates helps to forms the cell wall.  Cellulose is a carbohydrate and it is found the plant cell wall.

Is it possible for you to be more related to one grandparent than another?

Answers

Answer:

No because you should get half the DNA from your parents meaning you should be related to the grandparents equally

Answer:

The question isn't clear, can you restate it ?

Explanation:

FIRST TO ANSWER IN DIFFERENT SENTENCES GETS BRAINLIEST

Answers

Answer:

1.An example of Batesian mimicry is when the yummy viceroy butterfly mimics the orange and black coloration of the distasteful monarch butterfly. ... Wasmannian mimicry occurs when the mimic resembles it's host (the model) in order to live within the same nest or structure. For example, several beetles closely resemble ants

2.Orange and black Monarchs (Danaus plexippus) are among the most familiar and easily recognizable butterflies found in the vivarium. Bright colors and distinctive wing patterns can be an example of aposematism, also known as a warning coloration.

Explanation:

please mark me as the brainliest answer and please follow me for more answers to your questions

Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle

Answers

The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Glycolysis

Glycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.

Citric acid cycle

This is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.

Acetyl CoA formation

The pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.

Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539

Answer:

It's B

Explanation:

I took one for the team.

1. Why were populations able to get so big? What happened that allowed this to happen?

2. What do you think will happen if the populations of humans continued to increase

3. What could happen that could limit the population or cause it to decrease ( Stop growing )

Answers

Answer:

1. reproduction

2. we could run out of food as not enough is produced fast enough

3. lack of food, women and men who are infertile or diseases which can kill people

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

Describe one way the plants in a desert biome are adapted to survive?​

Answers

Answer:

The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.

Explanation: I hope this help's you some!!

Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?

A.Electron
B.Neutron
C.Nucleus
D.Proton

Answers

Answer:

Nucleus

Explanation:

How many atoms of each element are in the chemical formula NH4NO3?

1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen

Answers

C - 2 Nitrogen / 4 Hydrogen / 3 Oxygen

hope that helps :)

What molecules will carry the electrons to the electron transport chain?

Answers

Answer:

electron and nuetrons

The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.

These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.

The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.

Learn more about the electron transport chain, here:

https://brainly.com/question/33834922

#SPJ4

Other Questions
1)What is it about the structure of ATP that contributes to its ability to act as an energy currency? 2)When a phosphate is transferred from ATP, it can phosphorylate another molecule. How could this assist in allowing a protein to transport molecules against their concentration gradient? Lisa paid 45.30 for 15.9 gallons of gasoline.what was the cost per gallon, rounded to the nearest hundreath During a phase change, a substance undergoes a(n) *HELPreversible change from one state to another.irreversible change to a different substanceirreversible change from one state to another.reversible change to a different substance. Which compound forms a powerful acid and contains a halogen The amount of a market that a producer controls is called market share. How is market share related to pure competition? what does the process of fertilization create Find the slope of the line passing through the points (-8, 2) and (-8, - 7).slope: 15-7m=-5-2m solve the equation WILL GIVE BRAINLIEST!! PLEASE HELP!! What is the value of the expression 3.7+27 * 5/7 ? List several people the designated survivor is sequestered with. Marco spent $85.43 on a new pair ofshoes, $21 on a t-shirt, and $7.84 on apair of socks. If he gave the sales clerk$120, how much change should hereceive? Yo can someone help me out HELP PLZ THIS IS A EMERGANCYthe following letter, Abigail Adams (17441818) writes to her son John Quincy Adams, who is traveling abroad with his father, John Adams, a United States diplomat and later the countrys second president. Read the letter carefully. Then, in a well-developed essay, analyze the rhetorical strategies Adams uses to advise her son. Support your analysis with specific references to the text. need to have 3 paragraphs12 January, 1780.MY DEAR SON,I hope you have had no occasion, either fromenemies or the dangers of the sea, to repent yoursecond voyage to France. If I had thought yourreluctance arose from proper deliberation, or that you5 were capable of judging what was most for your ownLinebenefit, I should not have urged you to accompanyyour father and brother when you appeared so averseto the voyage.You, however, readily submitted to my advice,10 and, I hope, will never have occasion yourself, norgive me reason, to lament it. Your knowledge of thelanguage must give you greater advantages now thanyou could possibly have reaped whilst ignorant of it;and as you increase in years, you will find your15 understanding opening and daily improving.Some author, that I have met with, compares ajudicious traveller to a river, that increases its streamthe further it flows from its source; or to certainsprings, which, running through rich veins of20 minerals, improve their qualities as they pass along.It will be expected of you, my son, that, as you arefavored with superior advantages under the instructiveeye of a tender parent, your improvement should bearsome proportion to your advantages. Nothing is25 wanting with you but attention, diligence, and steadyapplication. Nature has not been deficient.These are times in which a genius would wish tolive. It is not in the still calm of life, or the reposeof a pacific station, that great characters are formed.30 Would Cicero have shone so distinguished an orator ifhe had not been roused, kindled, and inflamed by thetyranny of Catiline, Verres, and Mark Anthony? Thehabits of a vigorous mind are formed in contendingwith difficulties. All history will convince you of this,35 and that wisdom and penetration are the fruit ofexperience, not the lessons of retirement and leisure.Great necessities call out great virtues. When a mindis raised and animated by scenes that engage theheart, then those qualities, which would otherwise lie40 dormant, wake into life and form the character of thehero and the statesman. War, tyranny, and desolationare the scourges of the Almighty, and ought no doubtto be deprecated. Yet it is your lot, my son, to be aneyewitness of these calamities in your own native45 land, and, at the same time, to owe your existenceamong a people who have made a glorious defence oftheir invaded liberties, and who, aided by a generousand powerful ally, with the blessing of Heaven, willtransmit this inheritance to ages yet unborn.50 Nor ought it to be one of the least of yourincitements towards exerting every power and facultyof your mind, that you have a parent who has taken solarge and active a share in this contest, and dischargedthe trust reposed in him with so much satisfaction as55 to be honored with the important embassy which atpresent calls him abroad.The strict and inviolable regard you have ever paidto truth, gives me pleasing hopes that you will notswerve from her dictates, but add justice, fortitude,60 and every manly virtue which can adorn a goodcitizen, do honor to your country, and render yourparents supremely happy, particularly your everaffectionate mother Write three to five sentences describing how Robin Hoods pride brings him into conflict with the archer, the sheriff, and the king. The only continent that has only one national government is________ The rectangle shown is enlarged such that each side is multiplied by the value of the width, 2x. Which expression represents the perimeter of the enlarged rectangle? The rectangle shown is enlarged such that each side is multiplied by the value of the width, 2x. Which expression represents the perimeter of the enlarged rectangle? A. 4x + 2y B. 8x^2 + 2y C. 4x^2+2xy D. 8x^2+4xy how would you share information and communicate news and events Write an equation for the description.Tanmayi wants to raise $150 for a school fundraiser. She has raised $120 so far. How much more does sheneed to reach her goal? Let m be how much more is needed.Plzzzz hellpppp explain how the burning of fossil fuels by humans could affect the red reef crab Solve this equation, and show work. worth 40 points.