Answers
Answer:
its b
Explanation:
I remember I did this
Related Questions
Viruses differ from bacteria cells in that all viruses -
A)Causes insect-borne disease
B)Have rigid cell walls
C)Can be destroyed by antibiotics
D)Must be reproduced in living cells
Answers
Answer:
D) Must be reproduced in living cells
Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information
B. disrupting meiosis and the synthesis of amino acids into a sequence
C. producing the inorganic molecules needed for normal cell growth
D. directing the synthesis of proteins necessary for proper cell function
Answers
D. directing the synthesis of proteins necessary for proper cell function
I hope this helps a little.
What is the function of cilia in the respiratory system? A. Move gases into the blood. B. Move food into the stomach. C. Move mucus into the throat. D. Move air into the lungs
Answers
Answer:
C or B sorry if I didn't help you
Explanation:
have a great day buddy
The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8. Which statement predicts how the stream's ecosystem will most likely be impacted? A The flow rate of the stream will increase B. The flow rate of the stream will decrease. с The number of fish in the stream will increase. D The number of fish in the stream will decrease.
Answers
The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease. Thus, option D is correct.
What is the procedure to indicate the pH of the water stream?The acidity of the water in a stream is indicated by its pH. Historically, a certain stream has had a pH of 6.0. Acid rain has caused the stream's pH to become 4.8.The flow rate of the stream will decrease. The number of fish in the stream will increase and the number of fish in the stream will decrease.
Acid rain is a form of rain with high concentration of hydrogen ions and is acidic in nature. pH of these rains is low and pH is the negative logarithmic of hydrogen ion concentration. It is known as power of hydrogen.
The animal which has the lowest value of pH will be able to tolerate the acid rain more and will be last to die. From the tolerance range of the animals, frogs has the lowest pH for survival which is 4 and it can bear more acid rain than the rest of the animals will be the last to die.
Therefore, The statement predicts how the stream's ecosystem will most likely be impacted is the number of fish in the stream will decrease. Thus, option D is correct.
Learn more about acid rain on:
https://brainly.com/question/11543614
#SPJ2
What makes an isotope radioactive? Are all isotopes radioactive?
Answers
Answer:
Radioactive Elements
In elements with more than 83 protons, all of the isotopes are radioactive. ... The force of repulsion among all those protons makes the nuclei unstable. Elements with more than 92 protons have such unstable nuclei that they don't even exist in nature.
Explanation:
hope it helps you
follow me for more
I'm willing to help
Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.
Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.
Answers
Answer:
I'm in school I'll help you when get home around 4:30
Outline the process of the Carbon Cycle.
Answers
Answer:
Carbon Cycle Definition
Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.
Carbon Cycle Steps
Following are the major steps involved in the process of the carbon cycle:
Carbon present in the atmosphere is absorbed by plants for photosynthesis.
These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.
These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.
Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.
These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.
Hope it helps!!!
Many scientific explanations for the origin of DNA and life have been proposed over the years. These hypotheses explain how
inorganic molecules became organic monomers, such as amino acids, sugars, phosphates, and bases. But this still didn't explain
where living things came from. If macromolecules were able to form on early Earth, this still leaves us with the question of how
the polymers would have become self-replicating, a basic criteria for life. There are several ideas but little certainty. Some of the
common ideas include: the RNA world hypothesis, the genes first hypothesis, and the metabolism first hypothesis."
Which of these statements is proposed by the genes first hypothesis?
A)
RNA is highly stable.
B)
The first life forms were self-replicating nucleic acids, such as RNA or DNA
RNA is able to store and pass on genetic information.
D)
RNA contains less nitrogen bases than DNA and thus, is a simpler molecule.
E)
Ribosomal RNA (TRNA) and transfer RNA (TRNA) are the primary molecules
responsible for protein synthesis.
Answers
The first life forms were self-replicating nucleic acids, such as RNA or DNA, RNA is able to store and pass on genetic information.
What is the difference between RNA and DNA?There are two differences that determine DNA from RNA,
(a) RNA contains the sugar ribose, while DNA contains the slightly different sugar deoxyribose, and
(b) RNA has the nucleobase uracil while DNA contains thymine.
Thus, options, A and C are correct, RNA is adapt of both storing genetic data and catalyzing chemical responses.
To learn more about the RNA click here:
https://brainly.com/question/13868647
15 points answer please
Answers
Answer:
B
Explanation:
The particles will stop completely
Which molecule is produced in the aerobic breakdown of a glucose molecule?
A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH
Answers
[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]
E. NADPH
thankshope it helpspls mark as brainliestAnswer:
E
Explanation:
it enters the citric acid cycle and generates reducing equivalents in the form of NADPH
Why do we use pH and the pH scale?
Answers
Answer:
We use pH as a measurement of how acidic something is. pH scale is what we use to determine how acidic it is. i tried hope it helps:)
Explanation:
what are the differences between ligaments & tendons
Answers
Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!
What do agriculture and urbanization have in common?
Answers
Answer:
Agriculture and urbanization both have the goal of expanding human value of living.
Explanation:
Answer:
Explanation:
Basically both of them benefit each other .
Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands. It can also bring major challenges for urban and rural food security.
Hope this helped !
GIVING BRAINLIEST AND EXTRA POINTS!!
The octopus can change its coloring to blend into its environment, and the sweet pinesap plant appears to look like dead leaves on the ground. How do these adaptations help the plant and animal survive?
A) They protect them from predators.
B) They protect them from the environment.
C) They allow them to stand out.
D) They allow them to reproduce.
Answers
why do some scientists believe that humans evolved from apes?
a: because fossil records show homologous structures indicating a common ancestor
b: because humans and apes lived around the same time period
Answers
Answer:
A
Explanation:
Because it is way more logic
What are the five main phases of the cell cycle? What are the main events in each?
Answers
Answer:
In the adult organism, mitosis plays a role in cell replacement, wound healing and tumour formation. Mitosis, although a continuous process, is conventionally divided into five stages: prophase, prometaphase, metaphase, anaphase and telophase.
Cell cycle has different stages called G1, S, G2, and M. G1 is the stage where the cell is preparing to divide. To do this, it then moves into the S phase where the cell copies all the DNA.
Explanation:
good luck
please mark me as a brainliest
Organisms such as yeast can reproduce through mitotic division. During this type of reproduction, nondisjunction is possible.
True
False
Answers
You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.
Answers
Answer:
C is the best answer
Explanation:
the dominate trait is in 3 of the four boxes
There is a 75% chance that each offspring will be tall. Therefore option C is correct.
When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.
The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.
The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.
Therefore option C There is a 75% chance that each offspring will be tall is correct.
Know more about genotype:
https://brainly.com/question/31515990
#SPJ5
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Answers
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.
Arturo ran a 3,000-meter race. His running time from start to finish was 10 minutes. What was Arturo's average speed?
Answers
Answer:
300 meters/min
Explanation:
average speed = distance / time
(3000 m) / (10 min) = 300 meter per minute
if you need it in meters/sec then just multiply 10 by 60 first and then continue
(3000 m) / (600 sec) = 5 m/s
A type of circuit that has only one path is called a —
Group of answer choices
series circuit
parallel circuit
open circuit
closed circuit
Answers
The answer is series circuit.
What type of bond holds nitrogen bases together? And, how many of these hold Guanine and Cytocine together?
Answers
Acid rain is caused by: *
*
O
a. Mass amount of CO2 in the atmosphere
O b. Reduction of pollutants
O c. Organisms that release acid into the atmosphere
O d. Planting more trees
Answers
Answer:
Mass amount of CO2 in the atmosphere
Lysogenic viruses do not
Answers
Answer:
Unlike a lytic virus, a lysogenic virus does not cause the host cell to lyse away. A lysogenic virus can remain inactive for a period of time. In lysogenic infection, viral DNA gets integrated with the host cell's DNA, where it is copied along with the host cell's DNA when the host cell replicates.
Explanation:
The owl is a nocturnal hunter of small mammals, insects, and other birds. An owl is an example of
A. Producer
B omnivore
C carnivore
D decomposer
Answers
Answer:
C carnivore:)
Explanation:
I need help on this one!
Answers
Answer:
Classify I beilieve!
Explanation: You would need to do this because in order for you to study it you would have to classify them.
The products in our society that contribute the most waste are those that are _____.
Answers
Answer:
disposable
Explanation:
Biodegradable products do not really present any problems because they can decompose on their own, thus they do not create any pollution. Aluminum is not as dangerous to the environment as plastics, for example.
Why does Mr. Brunner care for Percy so much?
Answers
explain how the genus and species name of an organism is properly written
Answers
Answer: The binomial system of nomenclature is structured so that the scientific name of a plant consists of two names: (1) the genus or generic name, and (2) the specific epithet or species name. ... The genus name is always underlined or italicized. The first letter of the genus name is always capitalized.
Explanation:
What are the factors that determine
the level of harm an introduced chemical
has on the enviroment?
PLEASE ANSWER QUICKLY
